RAB14 cDNA ORF Clone, Human, N-Myc tag

Cat: HG15033-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAB14 Reagents
CRO Services
Product recommended

All RAB14 Reagents
RAB14 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Human RAB14, member RAS oncogene family with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB14 cDNA ORF Clone, Human, N-Myc tag Alternative Names
FBP cDNA ORF Clone, Human;RAB-14 cDNA ORF Clone, Human
RAB14 Background Information
Full Name
RAB14, member RAS oncogene family

RAB14 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB14 cDNA ORF Clone in Cloning Vector, Rat RG83973-U
RAB14 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83973-ACGLN

RAB14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB14 cDNA ORF Clone in Cloning Vector, Mouse MG5A2036-U
RAB14 cDNA ORF Clone, Mouse, untagged MG5A2036-UT
RAB14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2036-ACGLN
RAB14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2036-ACG
RAB14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2036-ANG
RAB14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2036-ACR
RAB14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2036-ANR
RAB14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2036-CF
RAB14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2036-NF
RAB14 cDNA ORF Clone, Mouse, C-His tag MG5A2036-CH
RAB14 cDNA ORF Clone, Mouse, N-His tag MG5A2036-NH
RAB14 cDNA ORF Clone, Mouse, C-HA tag MG5A2036-CY
RAB14 cDNA ORF Clone, Mouse, N-HA tag MG5A2036-NY
RAB14 cDNA ORF Clone, Mouse, C-Myc tag MG5A2036-CM
RAB14 cDNA ORF Clone, Mouse, N-Myc tag MG5A2036-NM

RAB14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB14 cDNA ORF Clone in Cloning Vector, Human HG15033-G
RAB14 cDNA ORF Clone, Human, untagged HG15033-UT
RAB14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15033-ACGLN
RAB14 cDNA ORF Clone, Human, C-GFPSpark® tag HG15033-ACG
RAB14 cDNA ORF Clone, Human, N-GFPSpark® tag HG15033-ANG
RAB14 cDNA ORF Clone, Human, C-OFPSpark® tag HG15033-ACR
RAB14 cDNA ORF Clone, Human, N-OFPSpark® tag HG15033-ANR
RAB14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15033-CF
RAB14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15033-NF
RAB14 cDNA ORF Clone, Human, C-His tag HG15033-CH
RAB14 cDNA ORF Clone, Human, N-His tag HG15033-NH
RAB14 cDNA ORF Clone, Human, C-HA tag HG15033-CY
RAB14 cDNA ORF Clone, Human, N-HA tag HG15033-NY
RAB14 cDNA ORF Clone, Human, C-Myc tag HG15033-CM
RAB14 qPCR Primer Pairs, Human HP103661
info info
添加购物车成功! 添加购物车失败!