Protein C cDNA ORF Clone, Human, N-His tag

Cat: HG10196-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Protein C Reagents
CRO Services
Product recommended

All Protein C Reagents
Protein C cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1386 bp
Description
Full length Clone DNA of Human protein C (inactivator of coagulation factors Va and VIIIa) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Protein C cDNA ORF Clone, Human, N-His tag Alternative Names
APC cDNA ORF Clone, Human;PC cDNA ORF Clone, Human;PROC cDNA ORF Clone, Human;PROC1 cDNA ORF Clone, Human;THPH3 cDNA ORF Clone, Human;THPH4 cDNA ORF Clone, Human
Protein C Background Information
Full Name
protein C, inactivator of coagulation factors Va and VIIIa

Protein C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Protein C cDNA ORF Clone in Cloning Vector, Mouse MG50257-M
Protein C cDNA ORF Clone, Mouse, untagged MG50257-UT
Protein C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50257-ACGLN
Protein C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50257-ACG
Protein C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50257-ACR
Protein C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50257-CF
Protein C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50257-NF
Protein C cDNA ORF Clone, Mouse, C-His tag MG50257-CH
Protein C cDNA ORF Clone, Mouse, N-His tag MG50257-NH
Protein C cDNA ORF Clone, Mouse, C-HA tag MG50257-CY
Protein C cDNA ORF Clone, Mouse, N-HA tag MG50257-NY
Protein C cDNA ORF Clone, Mouse, C-Myc tag MG50257-CM
Protein C cDNA ORF Clone, Mouse, N-Myc tag MG50257-NM
Protein C qPCR Primer Pairs, Mouse MP200283

Protein C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Protein C cDNA ORF Clone in Cloning Vector, Human HG10196-M
Protein C cDNA ORF Clone, Human, untagged HG10196-UT
Protein C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10196-ACGLN
Protein C cDNA ORF Clone, Human, C-GFPSpark® tag HG10196-ACG
Protein C cDNA ORF Clone, Human, C-OFPSpark® tag HG10196-ACR
Protein C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10196-CF
Protein C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10196-NF
Protein C cDNA ORF Clone, Human, C-His tag HG10196-CH
Protein C cDNA ORF Clone, Human, C-HA tag HG10196-CY
Protein C cDNA ORF Clone, Human, N-HA tag HG10196-NY
Protein C cDNA ORF Clone, Human, C-Myc tag HG10196-CM
Protein C cDNA ORF Clone, Human, N-Myc tag HG10196-NM
Protein C qPCR Primer Pairs, Human HP100260
info info
添加购物车成功! 添加购物车失败!