Podoplanin cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11065-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Podoplanin Reagents
CRO Services
Product recommended

All Podoplanin Reagents
Podoplanin cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
717 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 117C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human podoplanin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.76kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Podoplanin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Podoplanin cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human Podoplanin Gene Expression validated Image 14376
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Podoplanin cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
AGGRUS cDNA ORF Clone, Human;GP36 cDNA ORF Clone, Human;Gp38 cDNA ORF Clone, Human;GP40 cDNA ORF Clone, Human;HT1A-1 cDNA ORF Clone, Human;OTS8 cDNA ORF Clone, Human;PA2.26 cDNA ORF Clone, Human;T1A cDNA ORF Clone, Human;T1A-2 cDNA ORF Clone, Human;T1A2 cDNA ORF Clone, Human;TI1A cDNA ORF Clone, Human
Podoplanin Background Information

Podoplanin, also known as PDPN, is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined. Alternatively spliced transcript variants encoding different isoforms have been identified.PDPN is a mucin-type glycoprotein negatively charged by extensive O-glycosylation and a high content of sialic acid, which expresses the adhesive property. It is selectively expressed in lymphatic endothelium as well as lymphangiomas, Kaposi sarcomas, and in a subset of angiosarcomas with probable lymphatic differentiation. PDPN may contribute to form odontoblastic fiber or function as the anchorage to the tooth development and in proliferating epithelial cells of cervical loop and apical bud. The intensity of podoplanin expression is negatively correlated with the expression of CD34 and factor VIII. Podoplanin would be useful as a diagnostic marker for epithelioid hemangioendothelioma in liver tumors.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
podoplanin
References
  • Kimura, N. et al., 2005,  Pathol Int. 55 (2): 83-86.
  • Ordóñez, N.G., 2006, Adv Anat Pathol. 13 (2): 83-88.
  • Wicki, A. et al., 2007,  Br. J. Cancer. 96 (1): 1-5.
  • Fujii,T. et al., 2008, Mod Pathol. 21 (2): 125-130.
  • Sawa,Y. et al., 2008, Acta Histochem Cytochem. 41 (5):121-126.
  • Kaddu, S. et al., 2009, Am J Dermatopathol.  31 (2): 137-139.
  • Podoplanin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Podoplanin cDNA ORF Clone in Cloning Vector, Rat RG81154-U
    Podoplanin cDNA ORF Clone, Rat, untagged RG81154-UT
    Podoplanin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81154-ACGLN
    Podoplanin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81154-ACG
    Podoplanin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81154-ACR
    Podoplanin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81154-CF
    Podoplanin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81154-NF
    Podoplanin cDNA ORF Clone, Rat, C-His tag RG81154-CH
    Podoplanin cDNA ORF Clone, Rat, N-His tag RG81154-NH
    Podoplanin cDNA ORF Clone, Rat, C-HA tag RG81154-CY
    Podoplanin cDNA ORF Clone, Rat, N-HA tag RG81154-NY
    Podoplanin cDNA ORF Clone, Rat, C-Myc tag RG81154-CM
    Podoplanin cDNA ORF Clone, Rat, N-Myc tag RG81154-NM
    Podoplanin qPCR Primer Pairs, Rat RP301110

    Podoplanin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Podoplanin cDNA ORF Clone in Cloning Vector, Mouse MG50256-M
    Podoplanin cDNA ORF Clone, Mouse, untagged MG50256-UT
    Podoplanin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50256-ACGLN
    Podoplanin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50256-ACG
    Podoplanin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50256-ACR
    Podoplanin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50256-CF
    Podoplanin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50256-NF
    Podoplanin cDNA ORF Clone, Mouse, C-His tag MG50256-CH
    Podoplanin cDNA ORF Clone, Mouse, N-His tag MG50256-NH
    Podoplanin cDNA ORF Clone, Mouse, C-HA tag MG50256-CY
    Podoplanin cDNA ORF Clone, Mouse, N-HA tag MG50256-NY
    Podoplanin cDNA ORF Clone, Mouse, C-Myc tag MG50256-CM
    Podoplanin cDNA ORF Clone, Mouse, N-Myc tag MG50256-NM
    Podoplanin qPCR Primer Pairs, Mouse MP200282

    Podoplanin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Podoplanin cDNA ORF Clone in Cloning Vector, Human HG11065-M
    Podoplanin cDNA ORF Clone, Human, untagged HG11065-UT
    Podoplanin cDNA ORF Clone, Human, C-GFPSpark® tag HG11065-ACG
    Podoplanin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11065-ACGLN
    Podoplanin cDNA ORF Clone, Human, C-OFPSpark® tag HG11065-ACR
    Podoplanin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11065-NF
    Podoplanin cDNA ORF Clone, Human, C-His tag HG11065-CH
    Podoplanin cDNA ORF Clone, Human, N-His tag HG11065-NH
    Podoplanin cDNA ORF Clone, Human, C-HA tag HG11065-CY
    Podoplanin cDNA ORF Clone, Human, N-HA tag HG11065-NY
    Podoplanin cDNA ORF Clone, Human, C-Myc tag HG11065-CM
    Podoplanin cDNA ORF Clone, Human, N-Myc tag HG11065-NM
    Podoplanin qPCR Primer Pairs, Human HP100937
    info info
    添加购物车成功! 添加购物车失败!