PXMP4 cDNA ORF Clone, Human, untagged

Cat: HG14232-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PXMP4 Reagents

CRO Services

Product recommended


All PXMP4 Reagents

PXMP4 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Human peroxisomal membrane protein 4, 24kDA.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PXMP4 cDNA ORF Clone, Human, untagged Alternative Names

PMP24 cDNA ORF Clone, Human

PXMP4 Background Information

Full Name
peroxisomal membrane protein 4

PXMP4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PXMP4 cDNA ORF Clone in Cloning Vector, Mouse MG52751-G
PXMP4 cDNA ORF Clone, Mouse, untagged MG52751-UT
PXMP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52751-ACGLN
PXMP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52751-ACG
PXMP4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52751-ANG
PXMP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52751-ACR
PXMP4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52751-ANR
PXMP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52751-CF
PXMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52751-NF
PXMP4 cDNA ORF Clone, Mouse, C-His tag MG52751-CH
PXMP4 cDNA ORF Clone, Mouse, N-His tag MG52751-NH
PXMP4 cDNA ORF Clone, Mouse, C-HA tag MG52751-CY
PXMP4 cDNA ORF Clone, Mouse, N-HA tag MG52751-NY
PXMP4 cDNA ORF Clone, Mouse, C-Myc tag MG52751-CM
PXMP4 cDNA ORF Clone, Mouse, N-Myc tag MG52751-NM

PXMP4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PXMP4 cDNA ORF Clone in Cloning Vector, Human HG14232-G
PXMP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14232-ACGLN
PXMP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14232-ACG
PXMP4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14232-ANG
PXMP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14232-ACR
PXMP4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14232-ANR
PXMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14232-CF
PXMP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14232-NF
PXMP4 cDNA ORF Clone, Human, C-His tag HG14232-CH
PXMP4 cDNA ORF Clone, Human, N-His tag HG14232-NH
PXMP4 cDNA ORF Clone, Human, C-HA tag HG14232-CY
PXMP4 cDNA ORF Clone, Human, N-HA tag HG14232-NY
PXMP4 cDNA ORF Clone, Human, C-Myc tag HG14232-CM
PXMP4 cDNA ORF Clone, Human, N-Myc tag HG14232-NM
PXMP4 qPCR Primer Pairs, Human HP102882
info info
添加购物车成功! 添加购物车失败!