Nectin 3 cDNA ORF Clone, Human, N-His tag

Cat: HG10852-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Nectin 3 Reagents
CRO Services
Product recommended

All Nectin 3 Reagents
Nectin 3 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1566 bp
Description
Full length Clone DNA of Human poliovirus receptor-related 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Nectin 3 cDNA ORF Clone, Human, N-His tag Alternative Names
CD113 cDNA ORF Clone, Human;CDw113 cDNA ORF Clone, Human;DKFZp566B0846 cDNA ORF Clone, Human;FLJ90624 cDNA ORF Clone, Human;nectin-3 cDNA ORF Clone, Human;PPR3 cDNA ORF Clone, Human;PRR3 cDNA ORF Clone, Human;PVRL3 cDNA ORF Clone, Human;PVRR3 cDNA ORF Clone, Human
Nectin 3 Background Information

Poliovirus receptor-related 3 (PVRL3), also known as Nectin-3 and CD113, is a member of the nectin family. PVRL3/Nectin-3 is an 83 kDa, type I transmembrane glycoprotein. Its precursor is 549 amino acids (aa) in length and contains an extended signal sequence of 57 aa, an extracellular domain (ECD) of 347 aa, a transmembrane segment of 21 aa, and a cytoplasmic region of 124 aa. Nectin-3 has three splicing variants, nectin-3alpha (biggest), -3beta (middle), and -3gamma (smallest). It is predominantly expressed in testis and placenta as well as in various cell lines, including epithelial cell lines. PVRL3/Nectin-3 plays a role in cell-cell adhesion through heterophilic trans-interactions with nectin-like proteins or nectins, such as trans-interaction with PVRL2/Nectin-2 at Sertoli-spermatid junctions. PVRL3/Nectin-3 is thus involved in the formation of cell-cell junctions, including adherens junctions and synapses. It has been shown to induce endocytosis-mediated down-regulation of PVR from the cell surface, resulting in reduction of cell movement and proliferation.

Full Name
poliovirus receptor-related 3
References
  • Satoh-Horikawa, et al. (2000). Nectin-3, a new member of immunoglobulin-like cell adhesion molecules that shows homophilic and heterophilic cell-cell adhesion activities. J Biol Chem (UNITED STATES) . 275 (14): 10291-9.
  • Reymond N, et al. (2000). Human nectin3/PRR3: a novel member of the PVR/PRR/nectin family that interacts with afadin. Gene (NETHERLANDS). 255 (2): 347-55.
  • Nectin 3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Nectin 3 cDNA ORF Clone, Mouse, untagged MG58665-UT
    Nectin 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58665-ACGLN
    Nectin 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58665-ACG
    Nectin 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58665-ACR
    Nectin 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58665-CF
    Nectin 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58665-NF
    Nectin 3 cDNA ORF Clone, Mouse, C-His tag MG58665-CH
    Nectin 3 cDNA ORF Clone, Mouse, N-His tag MG58665-NH
    Nectin 3 cDNA ORF Clone, Mouse, C-HA tag MG58665-CY
    Nectin 3 cDNA ORF Clone, Mouse, N-HA tag MG58665-NY
    Nectin 3 cDNA ORF Clone, Mouse, C-Myc tag MG58665-CM
    Nectin 3 cDNA ORF Clone, Mouse, N-Myc tag MG58665-NM

    Nectin 3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Nectin 3 cDNA ORF Clone in Cloning Vector, Human HG10852-M
    Nectin 3 cDNA ORF Clone, Human, untagged HG10852-UT
    Nectin 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10852-ACGLN
    Nectin 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10852-ACG
    Nectin 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10852-ACR
    Nectin 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10852-CF
    Nectin 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10852-NF
    Nectin 3 cDNA ORF Clone, Human, C-His tag HG10852-CH
    Nectin 3 cDNA ORF Clone, Human, C-HA tag HG10852-CY
    Nectin 3 cDNA ORF Clone, Human, N-HA tag HG10852-NY
    Nectin 3 cDNA ORF Clone, Human, C-Myc tag HG10852-CM
    Nectin 3 cDNA ORF Clone, Human, N-Myc tag HG10852-NM
    Nectin 3 qPCR Primer Pairs, Human HP100922
    info info
    添加购物车成功! 添加购物车失败!