Parvalbumin cDNA ORF Clone, Human, N-HA tag

Cat: HG15333-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Parvalbumin Reagents
CRO Services
Product recommended

All Parvalbumin Reagents
Parvalbumin cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
333 bp
Description
Full length Clone DNA of Human parvalbumin with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Parvalbumin cDNA ORF Clone, Human, N-HA tag Alternative Names
D22S749 cDNA ORF Clone, Human
Parvalbumin Background Information
Full Name
parvalbumin

Parvalbumin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Parvalbumin cDNA ORF Clone in Cloning Vector, Mouse MG57126-U
Parvalbumin cDNA ORF Clone, Mouse, untagged MG57126-UT
Parvalbumin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57126-ACGLN
Parvalbumin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57126-ACG
Parvalbumin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57126-ANG
Parvalbumin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57126-ACR
Parvalbumin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57126-ANR
Parvalbumin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57126-CF
Parvalbumin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57126-NF
Parvalbumin cDNA ORF Clone, Mouse, C-His tag MG57126-CH
Parvalbumin cDNA ORF Clone, Mouse, N-His tag MG57126-NH
Parvalbumin cDNA ORF Clone, Mouse, C-HA tag MG57126-CY
Parvalbumin cDNA ORF Clone, Mouse, N-HA tag MG57126-NY
Parvalbumin cDNA ORF Clone, Mouse, C-Myc tag MG57126-CM
Parvalbumin cDNA ORF Clone, Mouse, N-Myc tag MG57126-NM

Parvalbumin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Parvalbumin cDNA ORF Clone in Cloning Vector, Human HG15333-G
Parvalbumin cDNA ORF Clone, Human, untagged HG15333-UT
Parvalbumin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15333-ACGLN
Parvalbumin cDNA ORF Clone, Human, C-GFPSpark® tag HG15333-ACG
Parvalbumin cDNA ORF Clone, Human, N-GFPSpark® tag HG15333-ANG
Parvalbumin cDNA ORF Clone, Human, C-OFPSpark® tag HG15333-ACR
Parvalbumin cDNA ORF Clone, Human, N-OFPSpark® tag HG15333-ANR
Parvalbumin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15333-CF
Parvalbumin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15333-NF
Parvalbumin cDNA ORF Clone, Human, C-His tag HG15333-CH
Parvalbumin cDNA ORF Clone, Human, N-His tag HG15333-NH
Parvalbumin cDNA ORF Clone, Human, C-HA tag HG15333-CY
Parvalbumin cDNA ORF Clone, Human, C-Myc tag HG15333-CM
Parvalbumin cDNA ORF Clone, Human, N-Myc tag HG15333-NM
Parvalbumin qPCR Primer Pairs, Human HP103957
info info
添加购物车成功! 添加购物车失败!