After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTX3 ORF mammalian expression plasmid, C-His tag

Datasheet Reviews Related Products Protocols
Human PTX3 cDNA Clone Product Information
NCBI RefSeq:NM_002852
RefSeq ORF Size:1146bp
cDNA Description:Full length Clone DNA of Homo sapiens pentraxin-related gene, rapidly induced by IL-1 betaV with C terminal His tag.
Gene Synonym:TSG-14, TNFAIP5, PTX3
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-PTX3-His
Restriction Site:KpnI + XbaI (6kb + 1.2kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Pentraxin-related protein PTX3, also known as Tumor necrosis factor alpha-induced protein 5, Tumor necrosis factor-inducible gene 14 protein, TSG-14, PTX3 and TNFAIP5, is a secreted protein which contains one pentaxin domain. PTX3 plays a role in the regulation of innate resistance to pathogens, inflammatory reactions, possibly clearance of self-components and female fertility. Pentraxins are a family of evolutionarily conserved multifunctional pattern-recognition proteins characterized by a cyclic multimeric structure. Based on the primary structure of the subunit, the pentraxins are divided into two groups: short pentraxins and long pentraxins. C-reactive protein (CRP) and serum amyloid P-component (SAP) are the two short pentraxins. The prototype protein of the long pentraxin group is pentraxin 3 (PTX3). CRP and SAP are produced primarily in the liver in response to IL-6, while PTX3 is produced by a variety of tissues and cells and in particular by innate immunity cells in response to proinflammatory signals and Toll-like receptor (TLR) engagement. PTX3 is essential in female fertility by acting as a nodal point for the assembly of the cumulus oophorus hyaluronan-rich extracellular matrix. PTX3 interacts with several ligands, including growth factors, extracellular matrix components and selected pathogens, playing a role in complement activation and facilitating pathogen recognition by phagocytes, acting as a predecessor of antibodies. PTX3 may also contribute to the pathogenesis of atherosclerosis.

References
  • Rolph,M.S. et al., 2002, Arterioscler Thromb Vasc Biol. 22 (5):e10-4.
  • Mantovani A., et al., 2003, Vaccine. 21:S43-S47.
  • Luchetti,M.M. et al., 2004, Clin Exp Rheumatol. 22 (3):S66-72.
  • Mantovani, A. et al., 2006, Vascul Pharmacol. 45 (5):326-30.
  • Inforzato A., et al., 2008, J. Biol. Chem. 283:10147-61.
  • Size / Price
    Catalog:  HG12082-CH
    List Price:    (Save )
    Price:       [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"