PTTG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16378-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PTTG1 Reagents
CRO Services
Product recommended

All PTTG1 Reagents
PTTG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
648 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pituitary tumor-transforming 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + NotI(6kb+0.65kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PTTG1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PTTG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Cynomolgus CDCP1 Gene Plasmid Map 5627
Human PTTG1 Gene Expression validated Image 16942
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
PTTG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
EAP1 cDNA ORF Clone, Human;HPTTG cDNA ORF Clone, Human;PTTG cDNA ORF Clone, Human;TUTR1 cDNA ORF Clone, Human
PTTG1 Background Information
Full Name
pituitary tumor-transforming 1

PTTG1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PTTG1 cDNA ORF Clone in Cloning Vector, Rat RG81566-G

PTTG1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PTTG1 cDNA ORF Clone in Cloning Vector, Mouse MG58048-U
PTTG1 cDNA ORF Clone, Mouse, untagged MG58048-UT
PTTG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58048-ACG
PTTG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58048-ACGLN
PTTG1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58048-ANG
PTTG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58048-ACR
PTTG1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58048-ANR
PTTG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58048-CF
PTTG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58048-NF
PTTG1 cDNA ORF Clone, Mouse, C-His tag MG58048-CH
PTTG1 cDNA ORF Clone, Mouse, N-His tag MG58048-NH
PTTG1 cDNA ORF Clone, Mouse, C-HA tag MG58048-CY
PTTG1 cDNA ORF Clone, Mouse, N-HA tag MG58048-NY
PTTG1 cDNA ORF Clone, Mouse, C-Myc tag MG58048-CM
PTTG1 cDNA ORF Clone, Mouse, N-Myc tag MG58048-NM

PTTG1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PTTG1 cDNA ORF Clone in Cloning Vector, Human HG16378-G
PTTG1 cDNA ORF Clone, Human, untagged HG16378-UT
PTTG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16378-ACG
PTTG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16378-ACGLN
PTTG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16378-ANG
PTTG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16378-ACR
PTTG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16378-ANR
PTTG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16378-NF
PTTG1 cDNA ORF Clone, Human, C-His tag HG16378-CH
PTTG1 cDNA ORF Clone, Human, N-His tag HG16378-NH
PTTG1 cDNA ORF Clone, Human, C-HA tag HG16378-CY
PTTG1 cDNA ORF Clone, Human, N-HA tag HG16378-NY
PTTG1 cDNA ORF Clone, Human, C-Myc tag HG16378-CM
PTTG1 cDNA ORF Clone, Human, N-Myc tag HG16378-NM
PTTG1 qPCR Primer Pairs, Human HP105128
info info
添加购物车成功! 添加购物车失败!