After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTS Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human PTS cDNA Clone Product Information
NCBI RefSeq:BC009686
RefSeq ORF Size:438bp
cDNA Description:Full length Clone DNA of Homo sapiens 6-pyruvoyltetrahydropterin synthase with N terminal His tag.
Gene Synonym:FLJ97081, PTPS, PTS
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

PTS(6-pyruvoyltetrahydropterin synthase) belongs to the PTPS family. It catalyzes the elimination of inorganic triphosphate from dihydroneopterin triphosphate, which is the second and irreversible step in the biosynthesis of tetrahydrobiopterin from GTP. Tetrahydrobiopterin, also known as BH(4), is an essential cofactor and regulator of various enzyme activities, including enzymes involved in serotonin biosynthesis and NO synthase activity. Mutations in this gene result in hyperphenylalaninemia. PTS is involved in the biosynthesis of tetrahydrobiopterin, an essential cofactor of aromatic amino acid hydroxylases. PTS also catalyzes the transformation of 7,8-dihydroneopterin triphosphate into 6-pyruvoyl tetrahydropterin. Defects in PTS are the cause of BH4-deficient hyperphenylalaninemia type A (HPABH4A), also called 6-pyruvoyl-tetrahydropterin synthase deficiency (PTS deficiency) or hyperphenylalaninemia tetrahydrobiopterin-deficient due to PTS deficiency. HPABH4A is an autosomal recessive disorder characterized by depletion of the neurotransmitters dopamine and serotonin, and clinically by severe neurological symptoms unresponsive to the classic phenylalanine-low diet.

References
  • Ashida A, et al. (1994) A missense mutation (A to G) of 6-pyruvoyltetrahydropterin synthase in tetrahydrobiopterin-deficient form of hyperphenylalaninemia. Genomics. 24:408-10.
  • Ashida A, et al. (1993) cDNA cloning, expression in Escherichia coli and purification of human 6-pyruvoyl-tetrahydropterin synthase. Biochem. Biophys Res Commun. 195:1386-93.
  • Thoeny B, et al. (1992) Human 6-pyruvoyltetrahydropterin synthase: cDNA cloning and heterologous expression of the recombinant enzyme. Biochem Biophys Res Commun. 189:1437-43.
  • Size / Price
    Catalog: HG14332-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"