Quick Order

Human DEP1 / PTPRJ Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human PTPRJ cDNA Clone Product Information
NCBI RefSeq:NM_002843.3
RefSeq ORF Size:4014bp
cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, receptor type, J with N terminal His tag.
Gene Synonym:DEP1, SCC1, CD148, HPTPeta, R-PTP-ETA, PTPRJ
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

DEP1 / PTPRJ (Receptor-type tyrosine-protein phosphatase eta) is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. DEP1 / PTPRJ possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. DEP1 / PTPRJ is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. In stable MCF-7 cell lines lines, induction of DEP-1 expression inhibited breast cancer cell growth by 5-10-fold. These data describe PTPs expressed and regulated in breast cancer cell lines during differentiation and identify one PTP, DEP-1, that inhibits the growth of breast cancer cells in vitro.

References
  • Holsinger LJ, et al. (2002) The transmembrane receptor protein tyrosine phosphatase DEP1 interacts with p120. Oncogene. 21(46): 7067-76.
  • Huang X, et al. (2009) Natural variation at the DEP1 locus enhances grain yield in rice. Nat Genet. 41(4): 494-7.
  • Kuramochi S, et al. (1996) Molecular cloning and characterization of Byp, a murine receptor-type tyrosine phosphatase similar to human DEP-1. FEBS Lett. 378(1): 7-14.
  • Size / Price
    Catalog: HG13165-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"