Quick Order

Human CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human PTPRC cDNA Clone Product Information
    NCBI RefSeq:NM_002838.4
    RefSeq ORF Size:3921bp
    cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, receptor type, C transcript variant 1 with C terminal HA tag.
    Gene Synonym:LCA, LY5, B220, CD45, L-CA, T200, CD45R, GP180
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PTPRC qPCR primers for gene expression analysis, HP100852 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

    References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.
  • Size / Price
    Catalog: HG14197-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"