After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human PTPN2 cDNA Clone Product Information
NCBI RefSeq:NM_080422.1
RefSeq ORF Size:1164bp
cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 2, transcript variant 2 with C terminal HA tag.
Gene Synonym:PTPT, TCPTP, TC-PTP, TCELLPTP
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10571-ACG$225
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10571-ACR$225
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10571-ANG$225
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10571-ANR$225
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10571-CF$195
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10571-CH$195
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10571-CM$195
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10571-CY$195
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10571-M$75
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10571-M-F$195
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10571-NF$195
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10571-NH$195
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10571-NM$195
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10571-NY$195
Human PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmidHG10571-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"