PTP4A3 cDNA ORF Clone, Human, C-His tag

Cat: HG12189-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PTP4A3 Reagents
CRO Services
Product recommended

All PTP4A3 Reagents
PTP4A3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
492 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein tyrosine phosphatase type IVA, member 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.49kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PTP4A3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PTP4A3 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
PTP4A3 cDNA ORF Clone, Human, C-His tag Alternative Names
PRL-3 cDNA ORF Clone, Human;PRL-R cDNA ORF Clone, Human;PRL3 cDNA ORF Clone, Human
PTP4A3 Background Information
Full Name
protein tyrosine phosphatase type IVA, member 3

PTP4A3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PTP4A3 cDNA ORF Clone in Cloning Vector, Mouse MG52492-G
PTP4A3 cDNA ORF Clone, Mouse, untagged MG52492-UT
PTP4A3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52492-ACGLN
PTP4A3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52492-ACG
PTP4A3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52492-ANG
PTP4A3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52492-ACR
PTP4A3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52492-ANR
PTP4A3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52492-CF
PTP4A3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52492-NF
PTP4A3 cDNA ORF Clone, Mouse, C-His tag MG52492-CH
PTP4A3 cDNA ORF Clone, Mouse, N-His tag MG52492-NH
PTP4A3 cDNA ORF Clone, Mouse, C-HA tag MG52492-CY
PTP4A3 cDNA ORF Clone, Mouse, N-HA tag MG52492-NY
PTP4A3 cDNA ORF Clone, Mouse, C-Myc tag MG52492-CM
PTP4A3 cDNA ORF Clone, Mouse, N-Myc tag MG52492-NM
PTP4A3 qPCR Primer Pairs, Mouse MP202365

PTP4A3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PTP4A3 cDNA ORF Clone in Cloning Vector, Human HG12189-G
PTP4A3 cDNA ORF Clone, Human, untagged HG12189-UT
PTP4A3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12189-ACGLN
PTP4A3 cDNA ORF Clone, Human, C-GFPSpark® tag HG12189-ACG
PTP4A3 cDNA ORF Clone, Human, C-OFPSpark® tag HG12189-ACR
PTP4A3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12189-CF
PTP4A3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12189-NF
PTP4A3 cDNA ORF Clone, Human, N-His tag HG12189-NH
PTP4A3 cDNA ORF Clone, Human, C-HA tag HG12189-CY
PTP4A3 cDNA ORF Clone, Human, N-HA tag HG12189-NY
PTP4A3 cDNA ORF Clone, Human, C-Myc tag HG12189-CM
PTP4A3 cDNA ORF Clone, Human, N-Myc tag HG12189-NM
PTP4A3 qPCR Primer Pairs, Human HP101819
info info
添加购物车成功! 添加购物车失败!