PTP1B cDNA ORF Clone, Human, N-Myc tag

Cat: HG10304-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PTP1B Reagents
CRO Services
Product recommended

All PTP1B Reagents
PTP1B cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Description
Full length Clone DNA of Human protein tyrosine phosphatase, non-receptor type 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PTP1B cDNA ORF Clone, Human, N-Myc tag Alternative Names
PTP1B cDNA ORF Clone, Human;PTPN1 cDNA ORF Clone, Human
PTP1B Background Information

PTP1B, also known as PTPN1, belongs to the protein-tyrosine phosphatase (PTP) family. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. PTP1B contains 1 tyrosine-protein phosphatase domain and is expressed in many tissues. PTP1B is localized to the cytoplasmic face of the endoplasmic reticulum. PTP1B was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of PTP1B in cell growth control, and cell response to IFN stimulation.

Full Name
protein tyrosine phosphatase, non-receptor type 1
References
  • Frangioni JV, et al. (1992) The nontransmembrane tyrosine phosphatase PTP-1B localizes to the endoplasmic reticulum via its 35 amino acid C-terminal sequence. Cell. 68(3):545-60.
  • Zhu S, et al. (2007) PTP1B contributes to the oncogenic properties of colon cancer cells through Src activation. Cancer Res. 67(21):10129-37.
  • Aoki N, et al. (2000) A cytosolic protein-tyrosine phosphatase PTP1B specifically dephosphorylates and deactivates prolactin-activated STAT5a and STAT5b. J Biol Chem. 275(50):39718-26.
  • Stuible M, et al. (2008) PTP1B regulates cortactin tyrosine phosphorylation by targeting Tyr446. J Biol Chem. 283(23):15740-6.
  • PTP1B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PTP1B cDNA ORF Clone in Cloning Vector, Mouse MG51869-G
    PTP1B cDNA ORF Clone, Mouse, untagged MG51869-UT
    PTP1B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51869-ACGLN
    PTP1B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51869-ACG
    PTP1B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51869-ANG
    PTP1B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51869-ACR
    PTP1B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51869-ANR
    PTP1B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51869-CF
    PTP1B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51869-NF
    PTP1B cDNA ORF Clone, Mouse, C-His tag MG51869-CH
    PTP1B cDNA ORF Clone, Mouse, N-His tag MG51869-NH
    PTP1B cDNA ORF Clone, Mouse, C-HA tag MG51869-CY
    PTP1B cDNA ORF Clone, Mouse, N-HA tag MG51869-NY
    PTP1B cDNA ORF Clone, Mouse, C-Myc tag MG51869-CM
    PTP1B cDNA ORF Clone, Mouse, N-Myc tag MG51869-NM
    PTP1B qPCR Primer Pairs, Mouse MP201742

    PTP1B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PTP1B cDNA ORF Clone in Cloning Vector, Human HG10304-M
    PTP1B cDNA ORF Clone, Human, untagged HG10304-UT
    PTP1B cDNA ORF Clone, Human, C-GFPSpark® tag HG10304-ACG
    PTP1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10304-ACGLN
    PTP1B cDNA ORF Clone, Human, N-GFPSpark® tag HG10304-ANG
    PTP1B cDNA ORF Clone, Human, C-OFPSpark® tag HG10304-ACR
    PTP1B cDNA ORF Clone, Human, N-OFPSpark® tag HG10304-ANR
    PTP1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10304-CF
    PTP1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10304-NF
    PTP1B cDNA ORF Clone, Human, C-His tag HG10304-CH
    PTP1B cDNA ORF Clone, Human, N-His tag HG10304-NH
    PTP1B cDNA ORF Clone, Human, C-HA tag HG10304-CY
    PTP1B cDNA ORF Clone, Human, N-HA tag HG10304-NY
    PTP1B cDNA ORF Clone, Human, C-Myc tag HG10304-CM
    PTP1B qPCR Primer Pairs, Human HP100347
    info info
    添加购物车成功! 添加购物车失败!