PTP1B cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/2
Price:
Size:
Number:

PTP1B cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein tyrosine phosphatase, non-receptor type 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.36kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PTP1B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PTP1B cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

PTP1B cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

PTP1B cDNA ORF Clone, Human; PTPN1 cDNA ORF Clone, Human

PTP1B Background Information

PTP1B, also known as PTPN1, belongs to the protein-tyrosine phosphatase (PTP) family. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. PTP1B contains 1 tyrosine-protein phosphatase domain and is expressed in many tissues. PTP1B is localized to the cytoplasmic face of the endoplasmic reticulum. PTP1B was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of PTP1B in cell growth control, and cell response to IFN stimulation.
Full Name
protein tyrosine phosphatase, non-receptor type 1
References
  • Frangioni JV, et al. (1992) The nontransmembrane tyrosine phosphatase PTP-1B localizes to the endoplasmic reticulum via its 35 amino acid C-terminal sequence. Cell. 68(3):545-60.
  • Zhu S, et al. (2007) PTP1B contributes to the oncogenic properties of colon cancer cells through Src activation. Cancer Res. 67(21):10129-37.
  • Aoki N, et al. (2000) A cytosolic protein-tyrosine phosphatase PTP1B specifically dephosphorylates and deactivates prolactin-activated STAT5a and STAT5b. J Biol Chem. 275(50):39718-26.
  • Stuible M, et al. (2008) PTP1B regulates cortactin tyrosine phosphorylation by targeting Tyr446. J Biol Chem. 283(23):15740-6.
Add to Cart Successfully Add to Cart Failed