PTH1R cDNA ORF Clone, Human, N-HA tag

Cat: HG12232-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PTH1R Reagents
CRO Services
Product recommended

All PTH1R Reagents
PTH1R cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1002 bp
Description
Full length Clone DNA of Human parathyroid hormone 1 receptor with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PTH1R cDNA ORF Clone, Human, N-HA tag Alternative Names
MGC138426 cDNA ORF Clone, Human;MGC138452 cDNA ORF Clone, Human;PFE cDNA ORF Clone, Human;PTHR cDNA ORF Clone, Human;PTHR1 cDNA ORF Clone, Human
PTH1R Background Information

Parathyroid hormone / parathyroid hormone-related peptide receptor, also known as PTH / PTHrP type I receptor, PTH/PTHr receptor, Parathyroid hormone 1 receptor, PTH1 receptor, PTH1R and PTHR, is a multi-pass membrane protein which belongs to the G-protein coupled receptor 2 family. PTH1R is expressed in most tissues. It is most abundant in kidney, bone and liver. PTH1R is expressed in high levels in bone and kidney and regulates calcium ion homeostasis through activation of adenylate cyclase and phospholipase C. In bone, PTH1R is expressed on the surface of osteoblasts. When the receptor is activated, these cells in turn stimulate osteoclasts to ultimately increase the resorption rate. PTH1R is a receptor for parathyroid hormone and for parathyroid hormone-related peptide. The activity of PTH1R is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in PTH1R are the cause of Jansen metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), enchondromatosis multiple (ENCHOM), Eiken skeletal dysplasia (EISD) and primary failure of tooth eruption (PFE).

Full Name
parathyroid hormone 1 receptor
References
  • Schipani E., et al., 1993, Endocrinology 132:2157-2165.
  • Hopyan S., et al., 2002, Nat. Genet. 30:306-310.
  • Bastepe M., et al., 2004, J. Clin. Endocrinol. Metab. 89:3595-3600.
  • Duchatelet S., et al., 2005, Hum. Mol. Genet. 14:1-5.
  • Decker E., et al., 2008, Am. J. Hum. Genet. 83:781-786.
  • info info
    添加购物车成功! 添加购物车失败!