After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PTH1R/PTHR1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human PTH1R cDNA Clone Product Information
NCBI RefSeq:BC031578
RefSeq ORF Size:1002bp
cDNA Description:Full length Clone DNA of Homo sapiens parathyroid hormone 1 receptor with C terminal Myc tag.
Gene Synonym:PFE, PTHR, PTHR1, PTH1R
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Parathyroid hormone / parathyroid hormone-related peptide receptor, also known as PTH / PTHrP type I receptor, PTH/PTHr receptor, Parathyroid hormone 1 receptor, PTH1 receptor, PTH1R and PTHR, is a multi-pass membrane protein which belongs to the G-protein coupled receptor 2 family. PTH1R is expressed in most tissues. It is most abundant in kidney, bone and liver. PTH1R is expressed in high levels in bone and kidney and regulates calcium ion homeostasis through activation of adenylate cyclase and phospholipase C. In bone, PTH1R is expressed on the surface of osteoblasts. When the receptor is activated, these cells in turn stimulate osteoclasts to ultimately increase the resorption rate. PTH1R is a receptor for parathyroid hormone and for parathyroid hormone-related peptide. The activity of PTH1R is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in PTH1R are the cause of Jansen metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), enchondromatosis multiple (ENCHOM), Eiken skeletal dysplasia (EISD) and primary failure of tooth eruption (PFE).

References
  • Schipani E., et al., 1993, Endocrinology 132:2157-2165.
  • Hopyan S., et al., 2002, Nat. Genet. 30:306-310.
  • Bastepe M., et al., 2004, J. Clin. Endocrinol. Metab. 89:3595-3600.
  • Duchatelet S., et al., 2005, Hum. Mol. Genet. 14:1-5.
  • Decker E., et al., 2008, Am. J. Hum. Genet. 83:781-786.
  • Size / Price
    Catalog: HG12232-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"