Quick Order

Text Size:AAA

Human PTH1R/PTHR1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human PTH1R cDNA Clone Product Information
NCBI RefSeq:BC031578
RefSeq ORF Size:1002bp
cDNA Description:Full length Clone DNA of Homo sapiens parathyroid hormone 1 receptor with C terminal HA tag.
Gene Synonym:PFE, PTHR, PTHR1, PTH1R
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Parathyroid hormone / parathyroid hormone-related peptide receptor, also known as PTH / PTHrP type I receptor, PTH/PTHr receptor, Parathyroid hormone 1 receptor, PTH1 receptor, PTH1R and PTHR, is a multi-pass membrane protein which belongs to the G-protein coupled receptor 2 family. PTH1R is expressed in most tissues. It is most abundant in kidney, bone and liver. PTH1R is expressed in high levels in bone and kidney and regulates calcium ion homeostasis through activation of adenylate cyclase and phospholipase C. In bone, PTH1R is expressed on the surface of osteoblasts. When the receptor is activated, these cells in turn stimulate osteoclasts to ultimately increase the resorption rate. PTH1R is a receptor for parathyroid hormone and for parathyroid hormone-related peptide. The activity of PTH1R is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in PTH1R are the cause of Jansen metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), enchondromatosis multiple (ENCHOM), Eiken skeletal dysplasia (EISD) and primary failure of tooth eruption (PFE).

References
  • Schipani E., et al., 1993, Endocrinology 132:2157-2165.
  • Hopyan S., et al., 2002, Nat. Genet. 30:306-310.
  • Bastepe M., et al., 2004, J. Clin. Endocrinol. Metab. 89:3595-3600.
  • Duchatelet S., et al., 2005, Hum. Mol. Genet. 14:1-5.
  • Decker E., et al., 2008, Am. J. Hum. Genet. 83:781-786.
  • Size / Price
    Catalog: HG12232-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"