PTH / Parathyroid Hormone cDNA ORF Clone, Human, untagged

Cat: HG13192-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PTH / Parathyroid Hormone Reagents
CRO Services
Product recommended

All PTH / Parathyroid Hormone Reagents
PTH / Parathyroid Hormone cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
348 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human parathyroid hormone.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 0.35kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PTH / Parathyroid Hormone cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PTH / Parathyroid Hormone cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
PTH / Parathyroid Hormone cDNA ORF Clone, Human, untagged Alternative Names
PTH cDNA ORF Clone, Human;PTH1 cDNA ORF Clone, Human
PTH / Parathyroid Hormone Background Information

Parathyroid hormone (PTH), parathormone or parathyrin, is secreted by the chief cells of the parathyroid glands as a polypeptide. PTH elevates calcium level by dissolving the salts in bone and preventing their renal excretion. Parathyroid hormone (PTH) has been proved to play a pivotal role in maintaining myocardial contractility as well as effective natriuresis, and possible pathogenic mechanisms contributing to heart failure secondary to hypocalcemia and hypoparathyroidism. With the increased population of preosteoblastic lineages and the osteoblastic activation, Parathyroid hormone (PTH) drives anabolism in bone. Experiments have recently reported that PTH affects bone cells in a dual pathway - mediating osteoblastic (preosteoblastic) activities or osteocytic synthesis of sclerostin. Defects in PTH are a cause of familial isolated hypoparathyroidism (FIH), also called autosomal dominant hypoparathyroidism or autosomal dominant hypocalcemia. FIH is characterized by hypocalcemia and hyperphosphatemia due to inadequate secretion of parathyroid hormone. Symptoms are seizures, tetany and cramps.

Full Name
parathyroid hormone
References
  • Bedi B, et al. (2012) Silencing of parathyroid hormone (PTH) receptor 1 in T cells blunts the bone anabolic activity of PTH. Proc Natl Acad Sci U S A. 109(12): 725-33.
  • Hasegawa T, et al. (2012) Parathyroid hormone as a Bone anabolic agent. Biological function of bone cells on the PTH-driven anabolic effect. Clin Calcium. 22(3): 373-9.
  • Ito M. Parathyroid hormone as a Bone anabolic agent. Effect of PTH on bone structural properties. Clin Calcium. 22(3): 335-41.
  • info info
    添加购物车成功! 添加购物车失败!