AARSD1 cDNA ORF Clone, Human, N-His tag

Cat: HG14280-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AARSD1 Reagents
CRO Services
Product recommended

All AARSD1 Reagents
AARSD1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Description
Full length Clone DNA of Human PTGES3L-AARSD1 readthrough with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AARSD1 cDNA ORF Clone, Human, N-His tag Alternative Names
AARSD1 cDNA ORF Clone, Human
AARSD1 Background Information

AARSD1 belongs to the class-II aminoacyl-tRNA synthetase family, Alax-L subfamily. AARSD1 binds 1 zinc ion per subunit functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). Four transcript variants have been described for AARSD1: NM_025267.3, NM_001136042.2, NM_001142653.1 and NM_001142654.1. It has been determined that the latter two variants represent a distinct upstream locus, which is now represented by GeneID:100885848 (PTGES3L), while the former two variants represent readthrough transcripts between PTGES3L and this locus (AARSD1). The readthrough locus (PTGES3L-AARSD1) is now represented by GeneID:100885850.

Full Name
alanyl-tRNA synthetase domain containing 1
References
  • Tatham MH, et al. (2011) Comparative proteomic analysis identifies a role for SUMO in protein quality control. Oncogene. 19(17):2120-8.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.
  • AARSD1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    AARSD1 cDNA ORF Clone in Cloning Vector, Mouse MG52710-U
    AARSD1 cDNA ORF Clone, Mouse, untagged MG52710-UT
    AARSD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52710-ACG
    AARSD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52710-ACGLN
    AARSD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52710-ANG
    AARSD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52710-ACR
    AARSD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52710-ANR
    AARSD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52710-CF
    AARSD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52710-NF
    AARSD1 cDNA ORF Clone, Mouse, C-His tag MG52710-CH
    AARSD1 cDNA ORF Clone, Mouse, N-His tag MG52710-NH
    AARSD1 cDNA ORF Clone, Mouse, C-HA tag MG52710-CY
    AARSD1 cDNA ORF Clone, Mouse, N-HA tag MG52710-NY
    AARSD1 cDNA ORF Clone, Mouse, C-Myc tag MG52710-CM
    AARSD1 cDNA ORF Clone, Mouse, N-Myc tag MG52710-NM
    AARSD1 qPCR Primer Pairs, Mouse MP202581

    AARSD1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    AARSD1 cDNA ORF Clone in Cloning Vector, Human HG16842-U
    AARSD1 cDNA ORF Clone in Cloning Vector, Human HG14280-G
    AARSD1 cDNA ORF Clone, Human, untagged HG16842-UT
    AARSD1 cDNA ORF Clone, Human, untagged HG14280-UT
    AARSD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14280-ACG
    AARSD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16842-ACG
    AARSD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14280-ACGLN
    AARSD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16842-ACGLN
    AARSD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14280-ANG
    AARSD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16842-ANG
    AARSD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16842-ACR
    AARSD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14280-ACR
    AARSD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16842-ANR
    AARSD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14280-ANR
    AARSD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14280-CF
    AARSD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16842-CF
    AARSD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16842-NF
    AARSD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14280-NF
    AARSD1 cDNA ORF Clone, Human, C-His tag HG16842-CH
    AARSD1 cDNA ORF Clone, Human, C-His tag HG14280-CH
    AARSD1 cDNA ORF Clone, Human, N-His tag HG16842-NH
    AARSD1 cDNA ORF Clone, Human, C-HA tag HG14280-CY
    AARSD1 cDNA ORF Clone, Human, C-HA tag HG16842-CY
    AARSD1 cDNA ORF Clone, Human, N-HA tag HG14280-NY
    AARSD1 cDNA ORF Clone, Human, N-HA tag HG16842-NY
    AARSD1 cDNA ORF Clone, Human, C-Myc tag HG16842-CM
    AARSD1 cDNA ORF Clone, Human, C-Myc tag HG14280-CM
    AARSD1 cDNA ORF Clone, Human, N-Myc tag HG16842-NM
    AARSD1 cDNA ORF Clone, Human, N-Myc tag HG14280-NM
    AARSD1 qPCR Primer Pairs, Human HP102930
    info info
    添加购物车成功! 添加购物车失败!