After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AARSD1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human AARSD1 cDNA Clone Product Information
NCBI RefSeq:BC004172
RefSeq ORF Size:1578bp
cDNA Description:Full length Clone DNA of Homo sapiens PTGES3L-AARSD1 readthrough.
Gene Synonym:MGC2744, AARSD1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

AARSD1 belongs to the class-II aminoacyl-tRNA synthetase family, Alax-L subfamily. AARSD1 binds 1 zinc ion per subunit functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). Four transcript variants have been described for AARSD1: NM_025267.3, NM_001136042.2, NM_001142653.1 and NM_001142654.1. It has been determined that the latter two variants represent a distinct upstream locus, which is now represented by GeneID:100885848 (PTGES3L), while the former two variants represent readthrough transcripts between PTGES3L and this locus (AARSD1). The readthrough locus (PTGES3L-AARSD1) is now represented by GeneID:100885850.

References
  • Tatham MH, et al. (2011) Comparative proteomic analysis identifies a role for SUMO in protein quality control. Oncogene. 19(17):2120-8.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"