PSMF1 cDNA ORF Clone, Human, C-HA tag

Cat: HG13480-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSMF1 Reagents
CRO Services
Product recommended

All PSMF1 Reagents
PSMF1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
669 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) inhibitor subunit with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMF1 cDNA ORF Clone, Human, C-HA tag Alternative Names
PI31 cDNA ORF Clone, Human
PSMF1 Background Information
Full Name
proteasome (prosome, macropain) inhibitor subunit 1 (PI31)

PSMF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMF1 cDNA ORF Clone in Cloning Vector, Human HG17079-U
PSMF1 cDNA ORF Clone in Cloning Vector, Human HG13480-G
PSMF1 cDNA ORF Clone, Human, untagged HG13480-UT
PSMF1 cDNA ORF Clone, Human, untagged HG17079-UT
PSMF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17079-ACG
PSMF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13480-ACG
PSMF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17079-ACGLN
PSMF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13480-ACGLN
PSMF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13480-ANG
PSMF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17079-ANG
PSMF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17079-ACR
PSMF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13480-ACR
PSMF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13480-ANR
PSMF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17079-ANR
PSMF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17079-CF
PSMF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13480-CF
PSMF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17079-NF
PSMF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13480-NF
PSMF1 cDNA ORF Clone, Human, C-His tag HG13480-CH
PSMF1 cDNA ORF Clone, Human, C-His tag HG17079-CH
PSMF1 cDNA ORF Clone, Human, N-His tag HG13480-NH
PSMF1 cDNA ORF Clone, Human, N-His tag HG17079-NH
PSMF1 cDNA ORF Clone, Human, C-HA tag HG17079-CY
PSMF1 cDNA ORF Clone, Human, N-HA tag HG17079-NY
PSMF1 cDNA ORF Clone, Human, N-HA tag HG13480-NY
PSMF1 cDNA ORF Clone, Human, C-Myc tag HG13480-CM
PSMF1 cDNA ORF Clone, Human, C-Myc tag HG17079-CM
PSMF1 cDNA ORF Clone, Human, N-Myc tag HG13480-NM
PSMF1 cDNA ORF Clone, Human, N-Myc tag HG17079-NM
PSMF1 qPCR Primer Pairs, Human HP102180
info info
添加购物车成功! 添加购物车失败!