PSME3 cDNA ORF Clone, Human, C-HA tag

Cat: HG14682-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSME3 Reagents
CRO Services
Product recommended

All PSME3 Reagents
PSME3 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
765 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSME3 cDNA ORF Clone, Human, C-HA tag Alternative Names
HEL-S-283 cDNA ORF Clone, Human;Ki cDNA ORF Clone, Human;PA28-gamma cDNA ORF Clone, Human;PA28G cDNA ORF Clone, Human;PA28gamma cDNA ORF Clone, Human;REG-GAMMA cDNA ORF Clone, Human
PSME3 Background Information

PSME3, also known as PA28-gamma, is a subunit of proteasome. The 26S proteasome multicatalytic proteinase complex has a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. PSME3 gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring.

Full Name
proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
References
  • Albertsen HM. et al., 1994, Nat Genet. 7 (4): 472-9.
  • Zhang Zhuo. et al., 2008, EMBO J. 27 (6): 852-64.
  • Coux O. et al., 1996, Annu Rev Biochem. 65: 801-47.
  • info info
    添加购物车成功! 添加购物车失败!