After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PSME3 / PA28-gamma Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human PSME3 cDNA Clone Product Information
NCBI RefSeq:BC001423
RefSeq ORF Size:765bp
cDNA Description:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) with N terminal Flag tag.
Gene Synonym:Ki, PA28G, PA28gamma, REG-GAMMA, PA28-gamma
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PSME3, also known as PA28-gamma, is a subunit of proteasome. The 26S proteasome multicatalytic proteinase complex has a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. PSME3 gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring.

References
  • Albertsen HM. et al., 1994, Nat Genet. 7 (4): 472-9.
  • Zhang Zhuo. et al., 2008, EMBO J. 27 (6): 852-64.
  • Coux O. et al., 1996, Annu Rev Biochem. 65: 801-47.
  • Size / Price
    Catalog: HG14682-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"