PSME2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14640-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSME2 Reagents
CRO Services
Product recommended

All PSME2 Reagents
PSME2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
759 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human proteasome (prosome, macropain) activator subunit 2 (PA28 beta) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.76kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PSME2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSME2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
PSME2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
PA28B cDNA ORF Clone, Human;PA28beta cDNA ORF Clone, Human;REGbeta cDNA ORF Clone, Human
PSME2 Background Information

PSME2, also known as PA28b, is a subunit of proteasome. The 26S proteasome multicatalytic proteinase complex has a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. PSME2 gene encodes the beta subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three beta and three alpha subunits combine to form a heterohexameric ring.

Full Name
proteasome (prosome, macropain) activator subunit 2 (PA28 beta)
References
  • Ahn K. et al., 1996, J Biol Chem. 271 (30): 18237-42.
  • Rual Jean-François. et al., 2005, Nature. 437 (7062): 1173-8.
  • Ahn JY. et al., 1995, FEBS Lett. 366 (1): 37-42.
  • PSME2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PSME2 cDNA ORF Clone in Cloning Vector, Mouse MG59691-U
    PSME2 cDNA ORF Clone, Mouse, untagged MG59691-UT
    PSME2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59691-ACGLN
    PSME2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59691-ACG
    PSME2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59691-ANG
    PSME2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59691-ACR
    PSME2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59691-ANR
    PSME2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59691-CF
    PSME2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59691-NF
    PSME2 cDNA ORF Clone, Mouse, C-His tag MG59691-CH
    PSME2 cDNA ORF Clone, Mouse, N-His tag MG59691-NH
    PSME2 cDNA ORF Clone, Mouse, C-HA tag MG59691-CY
    PSME2 cDNA ORF Clone, Mouse, N-HA tag MG59691-NY
    PSME2 cDNA ORF Clone, Mouse, C-Myc tag MG59691-CM
    PSME2 cDNA ORF Clone, Mouse, N-Myc tag MG59691-NM

    PSME2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PSME2 cDNA ORF Clone in Cloning Vector, Human HG14640-G
    PSME2 cDNA ORF Clone, Human, untagged HG14640-UT
    PSME2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14640-ACG
    PSME2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14640-ACGLN
    PSME2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14640-ANG
    PSME2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14640-ACR
    PSME2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14640-ANR
    PSME2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14640-CF
    PSME2 cDNA ORF Clone, Human, C-His tag HG14640-CH
    PSME2 cDNA ORF Clone, Human, N-His tag HG14640-NH
    PSME2 cDNA ORF Clone, Human, C-HA tag HG14640-CY
    PSME2 cDNA ORF Clone, Human, N-HA tag HG14640-NY
    PSME2 cDNA ORF Clone, Human, C-Myc tag HG14640-CM
    PSME2 cDNA ORF Clone, Human, N-Myc tag HG14640-NM
    PSME2 qPCR Primer Pairs, Human HP103274
    info info
    添加购物车成功! 添加购物车失败!