PSMD14 cDNA ORF Clone, Human, N-His tag

Cat: HG15391-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMD14 Reagents
CRO Services
Product recommended

All PSMD14 Reagents
PSMD14 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
933 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMD14 cDNA ORF Clone, Human, N-His tag Alternative Names
PAD1 cDNA ORF Clone, Human;POH1 cDNA ORF Clone, Human;RPN11 cDNA ORF Clone, Human
PSMD14 Background Information
Full Name
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14

PSMD14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMD14 cDNA ORF Clone in Cloning Vector, Mouse MG53430-U
PSMD14 cDNA ORF Clone, Mouse, untagged MG53430-UT
PSMD14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53430-ACGLN
PSMD14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53430-ACG
PSMD14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53430-ANG
PSMD14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53430-ACR
PSMD14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53430-ANR
PSMD14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53430-CF
PSMD14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53430-NF
PSMD14 cDNA ORF Clone, Mouse, C-His tag MG53430-CH
PSMD14 cDNA ORF Clone, Mouse, N-His tag MG53430-NH
PSMD14 cDNA ORF Clone, Mouse, C-HA tag MG53430-CY
PSMD14 cDNA ORF Clone, Mouse, N-HA tag MG53430-NY
PSMD14 cDNA ORF Clone, Mouse, C-Myc tag MG53430-CM
PSMD14 cDNA ORF Clone, Mouse, N-Myc tag MG53430-NM

PSMD14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMD14 cDNA ORF Clone in Cloning Vector, Human HG15391-G
PSMD14 cDNA ORF Clone, Human, untagged HG15391-UT
PSMD14 cDNA ORF Clone, Human, C-GFPSpark® tag HG15391-ACG
PSMD14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15391-ACGLN
PSMD14 cDNA ORF Clone, Human, N-GFPSpark® tag HG15391-ANG
PSMD14 cDNA ORF Clone, Human, C-OFPSpark® tag HG15391-ACR
PSMD14 cDNA ORF Clone, Human, N-OFPSpark® tag HG15391-ANR
PSMD14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15391-CF
PSMD14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15391-NF
PSMD14 cDNA ORF Clone, Human, C-His tag HG15391-CH
PSMD14 cDNA ORF Clone, Human, C-HA tag HG15391-CY
PSMD14 cDNA ORF Clone, Human, N-HA tag HG15391-NY
PSMD14 cDNA ORF Clone, Human, C-Myc tag HG15391-CM
PSMD14 cDNA ORF Clone, Human, N-Myc tag HG15391-NM
PSMD14 qPCR Primer Pairs, Human HP104015
info info
添加购物车成功! 添加购物车失败!