PSMD12 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14274-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSMD12 Reagents
CRO Services
Product recommended

All PSMD12 Reagents
PSMD12 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1371 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMD12 cDNA ORF Clone, Human, C-Myc tag Alternative Names
p55 cDNA ORF Clone, Human;Rpn5 cDNA ORF Clone, Human
PSMD12 Background Information
Full Name
proteasome (prosome, macropain) 26S subunit, non-ATPase, 12

PSMD12 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMD12 cDNA ORF Clone in Cloning Vector, Rat RG88772-U
PSMD12 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88772-ACGLN

PSMD12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMD12 cDNA ORF Clone in Cloning Vector, Mouse MG52402-G
PSMD12 cDNA ORF Clone, Mouse, untagged MG52402-UT
PSMD12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52402-ACG
PSMD12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52402-ACGLN
PSMD12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52402-ANG
PSMD12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52402-ACR
PSMD12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52402-ANR
PSMD12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52402-CF
PSMD12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52402-NF
PSMD12 cDNA ORF Clone, Mouse, C-His tag MG52402-CH
PSMD12 cDNA ORF Clone, Mouse, N-His tag MG52402-NH
PSMD12 cDNA ORF Clone, Mouse, C-HA tag MG52402-CY
PSMD12 cDNA ORF Clone, Mouse, N-HA tag MG52402-NY
PSMD12 cDNA ORF Clone, Mouse, C-Myc tag MG52402-CM
PSMD12 cDNA ORF Clone, Mouse, N-Myc tag MG52402-NM
PSMD12 qPCR Primer Pairs, Mouse MP202275

PSMD12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMD12 cDNA ORF Clone in Cloning Vector, Human HG14274-G
PSMD12 cDNA ORF Clone, Human, untagged HG14274-UT
PSMD12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14274-ACGLN
PSMD12 cDNA ORF Clone, Human, C-GFPSpark® tag HG14274-ACG
PSMD12 cDNA ORF Clone, Human, N-GFPSpark® tag HG14274-ANG
PSMD12 cDNA ORF Clone, Human, C-OFPSpark® tag HG14274-ACR
PSMD12 cDNA ORF Clone, Human, N-OFPSpark® tag HG14274-ANR
PSMD12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14274-CF
PSMD12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14274-NF
PSMD12 cDNA ORF Clone, Human, C-His tag HG14274-CH
PSMD12 cDNA ORF Clone, Human, N-His tag HG14274-NH
PSMD12 cDNA ORF Clone, Human, C-HA tag HG14274-CY
PSMD12 cDNA ORF Clone, Human, N-HA tag HG14274-NY
PSMD12 cDNA ORF Clone, Human, N-Myc tag HG14274-NM
PSMD12 qPCR Primer Pairs, Human HP102924
info info
添加购物车成功! 添加购物车失败!