PSMD10 cDNA ORF Clone, Human, N-His tag

Cat: HG14290-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMD10 Reagents
CRO Services
Product recommended

All PSMD10 Reagents
PSMD10 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMD10 cDNA ORF Clone, Human, N-His tag Alternative Names
dJ889N15.2 cDNA ORF Clone, Human;p28 cDNA ORF Clone, Human;p28(GANK) cDNA ORF Clone, Human
PSMD10 Background Information
Full Name
proteasome (prosome, macropain) 26S subunit, non-ATPase, 10

PSMD10 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PSMD10 cDNA ORF Clone in Cloning Vector, Canine DG70122-U

PSMD10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMD10 cDNA ORF Clone in Cloning Vector, Mouse MG53829-U
PSMD10 cDNA ORF Clone, Mouse, untagged MG53829-UT
PSMD10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53829-ACGLN
PSMD10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53829-ACG
PSMD10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53829-ANG
PSMD10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53829-ACR
PSMD10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53829-ANR
PSMD10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53829-CF
PSMD10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53829-NF
PSMD10 cDNA ORF Clone, Mouse, C-His tag MG53829-CH
PSMD10 cDNA ORF Clone, Mouse, N-His tag MG53829-NH
PSMD10 cDNA ORF Clone, Mouse, C-HA tag MG53829-CY
PSMD10 cDNA ORF Clone, Mouse, N-HA tag MG53829-NY
PSMD10 cDNA ORF Clone, Mouse, C-Myc tag MG53829-CM
PSMD10 cDNA ORF Clone, Mouse, N-Myc tag MG53829-NM

PSMD10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMD10 cDNA ORF Clone in Cloning Vector, Human HG14290-G
PSMD10 cDNA ORF Clone, Human, untagged HG14290-UT
PSMD10 cDNA ORF Clone, Human, C-GFPSpark® tag HG14290-ACG
PSMD10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14290-ACGLN
PSMD10 cDNA ORF Clone, Human, N-GFPSpark® tag HG14290-ANG
PSMD10 cDNA ORF Clone, Human, C-OFPSpark® tag HG14290-ACR
PSMD10 cDNA ORF Clone, Human, N-OFPSpark® tag HG14290-ANR
PSMD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14290-CF
PSMD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14290-NF
PSMD10 cDNA ORF Clone, Human, C-His tag HG14290-CH
PSMD10 cDNA ORF Clone, Human, C-HA tag HG14290-CY
PSMD10 cDNA ORF Clone, Human, N-HA tag HG14290-NY
PSMD10 cDNA ORF Clone, Human, C-Myc tag HG14290-CM
PSMD10 cDNA ORF Clone, Human, N-Myc tag HG14290-NM
PSMD10 qPCR Primer Pairs, Human HP102940
info info
添加购物车成功! 添加购物车失败!