PSMC4 cDNA ORF Clone, Human, untagged

Cat: HG14452-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSMC4 Reagents
CRO Services
Product recommended

All PSMC4 Reagents
PSMC4 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1257 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) 26S subunit, ATPase, 4.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMC4 cDNA ORF Clone, Human, untagged Alternative Names
MIP224 cDNA ORF Clone, Human;RPT3 cDNA ORF Clone, Human;S6 cDNA ORF Clone, Human;TBP-7 cDNA ORF Clone, Human;TBP7 cDNA ORF Clone, Human
PSMC4 Background Information
Full Name
proteasome (prosome, macropain) 26S subunit, ATPase, 4

PSMC4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PSMC4 cDNA ORF Clone in Cloning Vector, Rhesus CG90720-G
PSMC4 cDNA ORF Clone, Rhesus, untagged CG90720-UT
PSMC4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90720-ACGLN
PSMC4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90720-ACG
PSMC4 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90720-ANG
PSMC4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90720-ACR
PSMC4 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90720-ANR
PSMC4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90720-CF
PSMC4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90720-NF
PSMC4 cDNA ORF Clone, Rhesus, C-His tag CG90720-CH
PSMC4 cDNA ORF Clone, Rhesus, N-His tag CG90720-NH
PSMC4 cDNA ORF Clone, Rhesus, C-HA tag CG90720-CY
PSMC4 cDNA ORF Clone, Rhesus, N-HA tag CG90720-NY
PSMC4 cDNA ORF Clone, Rhesus, C-Myc tag CG90720-CM
PSMC4 cDNA ORF Clone, Rhesus, N-Myc tag CG90720-NM

PSMC4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMC4 cDNA ORF Clone in Cloning Vector, Rat RG86112-U
PSMC4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86112-ACGLN

PSMC4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMC4 cDNA ORF Clone in Cloning Vector, Mouse MG51249-U
PSMC4 cDNA ORF Clone, Mouse, untagged MG51249-UT
PSMC4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51249-ACG
PSMC4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51249-ACGLN
PSMC4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51249-ANG
PSMC4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51249-ACR
PSMC4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51249-ANR
PSMC4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51249-CF
PSMC4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51249-NF
PSMC4 cDNA ORF Clone, Mouse, C-His tag MG51249-CH
PSMC4 cDNA ORF Clone, Mouse, N-His tag MG51249-NH
PSMC4 cDNA ORF Clone, Mouse, C-HA tag MG51249-CY
PSMC4 cDNA ORF Clone, Mouse, N-HA tag MG51249-NY
PSMC4 cDNA ORF Clone, Mouse, C-Myc tag MG51249-CM
PSMC4 cDNA ORF Clone, Mouse, N-Myc tag MG51249-NM
PSMC4 qPCR Primer Pairs, Mouse MP201132

PSMC4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMC4 cDNA ORF Clone in Cloning Vector, Human HG14452-G
PSMC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14452-ACGLN
PSMC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14452-ACG
PSMC4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14452-ANG
PSMC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14452-ACR
PSMC4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14452-ANR
PSMC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14452-CF
PSMC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14452-NF
PSMC4 cDNA ORF Clone, Human, C-His tag HG14452-CH
PSMC4 cDNA ORF Clone, Human, N-His tag HG14452-NH
PSMC4 cDNA ORF Clone, Human, C-HA tag HG14452-CY
PSMC4 cDNA ORF Clone, Human, N-HA tag HG14452-NY
PSMC4 cDNA ORF Clone, Human, C-Myc tag HG14452-CM
PSMC4 cDNA ORF Clone, Human, N-Myc tag HG14452-NM
PSMC4 qPCR Primer Pairs, Human HP103100
info info
添加购物车成功! 添加购物车失败!