PSMA3 cDNA ORF Clone, Human, C-His tag

Cat: HG15297-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSMA3 Reagents
CRO Services
Product recommended

All PSMA3 Reagents
PSMA3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
813 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human proteasome (prosome, macropain) subunit, alpha type, 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+0.81kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PSMA3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMA3 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
PSMA3 cDNA ORF Clone, Human, C-His tag Alternative Names
HC8 cDNA ORF Clone, Human;PSC3 cDNA ORF Clone, Human
PSMA3 Background Information
Full Name
proteasome (prosome, macropain) subunit, alpha type, 3

PSMA3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMA3 cDNA ORF Clone in Cloning Vector, Mouse MG51959-U
PSMA3 cDNA ORF Clone, Mouse, untagged MG51959-UT
PSMA3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51959-ACGLN
PSMA3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51959-ACG
PSMA3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51959-ANG
PSMA3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51959-ACR
PSMA3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51959-ANR
PSMA3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51959-CF
PSMA3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51959-NF
PSMA3 cDNA ORF Clone, Mouse, C-His tag MG51959-CH
PSMA3 cDNA ORF Clone, Mouse, N-His tag MG51959-NH
PSMA3 cDNA ORF Clone, Mouse, C-HA tag MG51959-CY
PSMA3 cDNA ORF Clone, Mouse, N-HA tag MG51959-NY
PSMA3 cDNA ORF Clone, Mouse, C-Myc tag MG51959-CM
PSMA3 cDNA ORF Clone, Mouse, N-Myc tag MG51959-NM
PSMA3 qPCR Primer Pairs, Mouse MP201832

PSMA3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMA3 cDNA ORF Clone in Cloning Vector, Human HG15297-G
PSMA3 cDNA ORF Clone, Human, untagged HG15297-UT
PSMA3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15297-ACGLN
PSMA3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15297-ACG
PSMA3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15297-ANG
PSMA3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15297-ACR
PSMA3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15297-ANR
PSMA3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15297-CF
PSMA3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15297-NF
PSMA3 cDNA ORF Clone, Human, N-His tag HG15297-NH
PSMA3 cDNA ORF Clone, Human, C-HA tag HG15297-CY
PSMA3 cDNA ORF Clone, Human, N-HA tag HG15297-NY
PSMA3 cDNA ORF Clone, Human, C-Myc tag HG15297-CM
PSMA3 cDNA ORF Clone, Human, N-Myc tag HG15297-NM
PSMA3 qPCR Primer Pairs, Human HP103923
info info
添加购物车成功! 添加购物车失败!