PSG6 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13808-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSG6 Reagents
CRO Services
Product recommended

All PSG6 Reagents
PSG6 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Human pregnancy specific beta-1-glycoprotein 6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSG6 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CGM3 cDNA ORF Clone, Human;PSBG-10 cDNA ORF Clone, Human;PSBG-12 cDNA ORF Clone, Human;PSBG-6 cDNA ORF Clone, Human;PSG10 cDNA ORF Clone, Human;PSG12 cDNA ORF Clone, Human;PSG6 cDNA ORF Clone, Human;PSGGB cDNA ORF Clone, Human
PSG6 Background Information

PSG6 is a pregnancy-specific glycoprotein(PSG). PSGs are secreted proteins which are produced by the rodent and primate placenta and play a critical role in pregnancy success. The levels of PSGs are highest during the third trimester of pregnancy, a time marked by the most profound suppression of MS disease attacks. PSGs regulate T-cell function. The regulation of T-cell function during pregnancy is likely the result of significant hormonal changes and may well involve immunoregulatory proteins derived from the placenta. Pregnancy specific glycoproteins (PSGs) are the most abundant placentally derived glycoproteins in the maternal serum. PSG1, PSG6, PSG6N, and PSG11 induce dose-dependent secretion of anti-inflammatory cytokines by human monocytes. Human and murine PSGs exhibit cross-species activity.

Full Name
pregnancy specific beta-1-glycoprotein 6
References
  • Teglund S, et al. (1995) Characterization of cDNA encoding novel pregnancy-specific glycoprotein variants. Biochem Biophys Res Commun. 211(2):656-64.
  • Grimwood J, et al.. (2004) The DNA sequence and biology of human chromosome 19. Nature. 428(6982):529-35.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • info info
    添加购物车成功! 添加购物车失败!