PSEN1 cDNA ORF Clone, Human, untagged

Cat: HG16272-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSEN1 Reagents
CRO Services
Product recommended

All PSEN1 Reagents
PSEN1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1392 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human presenilin 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6kb+1.39kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PSEN1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSEN1 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
PSEN1 cDNA ORF Clone, Human, untagged Alternative Names
AD3 cDNA ORF Clone, Human;FAD cDNA ORF Clone, Human;PS-1 cDNA ORF Clone, Human;PS1 cDNA ORF Clone, Human;S182 cDNA ORF Clone, Human
PSEN1 Background Information
Full Name
presenilin 1

PSEN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSEN1 cDNA ORF Clone in Cloning Vector, Mouse MG53123-U
PSEN1 cDNA ORF Clone, Mouse, untagged MG53123-UT
PSEN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53123-ACG
PSEN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53123-ACGLN
PSEN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53123-ACR
PSEN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53123-CF
PSEN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53123-NF
PSEN1 cDNA ORF Clone, Mouse, C-His tag MG53123-CH
PSEN1 cDNA ORF Clone, Mouse, N-His tag MG53123-NH
PSEN1 cDNA ORF Clone, Mouse, C-HA tag MG53123-CY
PSEN1 cDNA ORF Clone, Mouse, N-HA tag MG53123-NY
PSEN1 cDNA ORF Clone, Mouse, C-Myc tag MG53123-CM
PSEN1 cDNA ORF Clone, Mouse, N-Myc tag MG53123-NM

PSEN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSEN1 cDNA ORF Clone in Cloning Vector, Human HG16272-G
PSEN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16272-ACG
PSEN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16272-ACGLN
PSEN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16272-ACR
PSEN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16272-CF
PSEN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16272-NF
PSEN1 cDNA ORF Clone, Human, C-His tag HG16272-CH
PSEN1 cDNA ORF Clone, Human, N-His tag HG16272-NH
PSEN1 cDNA ORF Clone, Human, C-HA tag HG16272-CY
PSEN1 cDNA ORF Clone, Human, N-HA tag HG16272-NY
PSEN1 cDNA ORF Clone, Human, C-Myc tag HG16272-CM
PSEN1 cDNA ORF Clone, Human, N-Myc tag HG16272-NM
info info
添加购物车成功! 添加购物车失败!