PSAT1 cDNA ORF Clone, Human, N-HA tag

Cat: HG14187-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSAT1 Reagents
CRO Services
Product recommended

All PSAT1 Reagents
PSAT1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1113 bp
Description
Full length Clone DNA of Human phosphoserine aminotransferase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSAT1 cDNA ORF Clone, Human, N-HA tag Alternative Names
EPIP cDNA ORF Clone, Human;NLS2 cDNA ORF Clone, Human;PSA cDNA ORF Clone, Human;PSAT cDNA ORF Clone, Human;PSATD cDNA ORF Clone, Human
PSAT1 Background Information
Full Name
phosphoserine aminotransferase 1

PSAT1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
PSAT1 cDNA ORF Clone in Cloning Vector, Rabbit TG65128-G
PSAT1 cDNA ORF Clone, Rabbit, untagged TG65128-UT
PSAT1 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65128-ACGLN
PSAT1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65128-ACG
PSAT1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65128-ANG
PSAT1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65128-ACR
PSAT1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65128-ANR
PSAT1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65128-CF
PSAT1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65128-NF
PSAT1 cDNA ORF Clone, Rabbit, C-His tag TG65128-CH
PSAT1 cDNA ORF Clone, Rabbit, N-His tag TG65128-NH
PSAT1 cDNA ORF Clone, Rabbit, C-HA tag TG65128-CY
PSAT1 cDNA ORF Clone, Rabbit, N-HA tag TG65128-NY
PSAT1 cDNA ORF Clone, Rabbit, C-Myc tag TG65128-CM
PSAT1 cDNA ORF Clone, Rabbit, N-Myc tag TG65128-NM

PSAT1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSAT1 cDNA ORF Clone in Cloning Vector, Rat RG86043-U
PSAT1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86043-ACGLN

PSAT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSAT1 cDNA ORF Clone in Cloning Vector, Human HG14187-G
PSAT1 cDNA ORF Clone, Human, untagged HG14187-UT
PSAT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14187-ACG
PSAT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14187-ACGLN
PSAT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14187-ANG
PSAT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14187-ACR
PSAT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14187-ANR
PSAT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14187-CF
PSAT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14187-NF
PSAT1 cDNA ORF Clone, Human, C-His tag HG14187-CH
PSAT1 cDNA ORF Clone, Human, N-His tag HG14187-NH
PSAT1 cDNA ORF Clone, Human, C-HA tag HG14187-CY
PSAT1 cDNA ORF Clone, Human, C-Myc tag HG14187-CM
PSAT1 cDNA ORF Clone, Human, N-Myc tag HG14187-NM
PSAT1 qPCR Primer Pairs, Human HP102838
info info
添加购物车成功! 添加购物车失败!