Quick Order

Text Size:AAA

Human PRTFDC1 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human PRTFDC1 cDNA Clone Product Information
NCBI RefSeq:BC008662
RefSeq ORF Size:678bp
cDNA Description:Full length Clone DNA of Homo sapiens phosphoribosyl transferase domain containing 1 with C terminal His tag.
Gene Synonym:HHGP, PRTFDC1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

PRTFDC1 is a member of the purine/pyrimidine phosphoribosyltransferase family. It can bind GMP, IMP and alpha-D-5-phosphoribosyl 1-pyrophosphate (PRPP). The epigenetic silencing of PRTFDC1 by hypermethylation of the CpG island leads to a loss of PRTFDC1 function, which might be involved in squamous cell oral carcinogenesis. PRTFDC1 is a genetic modifier of HPRT-deficiency in the mouse and has important implications for unraveling the molecular etiology of lesch-Nyhan disease(LND). LND is a severe X-linked neurological disorder caused by a deficiency of hypoxanthine phosphoribosyltransferase. PRTFDC1 has a low, barely measurable phosphoribosyltransferase activity (in vitro).

References
  • Welin M. et al., 2010, FEBS J. 277 (23): 4920-30.
  • Keebaugh AC. et al., 2011, PLoS One. 6 (7): e22381.
  • Suzuki E. et al., 2007, Oncogene. 26 (57): 7921-32.
  • Size / Price
    Catalog: HG14023-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"