After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Enterokinase / PRSS7 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human TMPRSS15 cDNA Clone Product Information
NCBI RefSeq:NM_002772.1
RefSeq ORF Size:3060bp
cDNA Description:Full length Clone DNA of Homo sapiens protease, serine, 7 (enterokinase) with N terminal Flag tag.
Gene Synonym:ENTK, MGC133046, PRSS7
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Enterokinase, or Enteropeptidase is a type II transmembrane, which is a member of the trypsin family of serine proteases, and plays a key role in mammalian metabolism. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. The mature trypsin in turn activates other proenzymes including chymotrypsinogen, procarboxypeptidases, and proelastases. Enterokinase consists of two subunits linked by a disulfide bond. The heavy chain achors enterokinase in the intestinal brush border membrane and the light chain is the catalytic subunit, which has the same mechanism of action as trypsin and chymotrypsin. Enterokinase is the physiological activator of trypsinogen and has a specificity for the sequence (Asp)4-Lys-Ile. Because of its high specificity towards the amino acid sequence (Asp)(4)-Lys, enterokinase is a potential tool for the cleavage of fusion proteins, which are gaining more importance in biopharmaceutical production. In addition, Enterokinase is a tool protease widely utilized in the cleavage of recombinant fusion proteins.

References
  • Light A, et al. (1989) Enterokinase (enteropeptidase): comparative aspects. Trends Biochem Sci. 14(3): 110-2.
  • Kubitzki T, et al. (2009) Application of immobilized bovine enterokinase in repetitive fusion protein cleavage for the production of mucin 1. Biotechnol J. 4(11): 1610-8.
  • Zheng XL, et al. (2009) Enteropeptidase, a type II transmembrane serine protease. Front Biosci (Elite Ed). 1: 242-9.
  • Size / Price
    Catalog: HG10733-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"