Quick Order

Human Pancreasin/Marapsin/PRSS27 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human PRSS27 cDNA Clone Product Information
    NCBI RefSeq:NM_031948.3
    RefSeq ORF Size:873bp
    cDNA Description:Full length Clone DNA of Homo sapiens protease, serine 27 with N terminal HA tag.
    Gene Synonym:MPN, CAPH2, PRSS27
    Species:Human
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRSS27 qPCR primers for gene expression analysis, HP101643 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    The name "Pancreasin" because it is transcribed strongly in the pancreas. This secreted, tryptic serine protease, also known as Marapsin or PRSS27 (Protease, serine, 27), which is a member of the peptidase S1 family. Pancreasin is inhibited by benzamidine and leupeptin but resists several classic inhibitors of trypsin. Marapsin was constitutively expressed in nonkeratinizing stratified squamous epithelia of human esophagus, tonsil, cervix, larynx, and cornea. In fact, marapsin was the second most strongly up-regulated protease in psoriatic lesions, where expression was localized to the upper region of the hyperplastic epidermis. Similarly, in the hyperproliferative epithelium of regenerating murine skin wounds, marapsin localized to the suprabasal layers, where keratinocytes undergo squamous differentiation. Marapsin's restricted expression, localization, and cytokine-inducible expression suggest a role in the terminal differentiation of keratinocytes in hyperproliferating squamous epithelia.

    References
  • Bhagwandin VJ, et al. (2003) Structure and activity of human pancreasin, a novel tryptic serine peptidase expressed primarily by the pancreas. J Biol Chem. 278(5): 3363-71.
  • Li W, et al. (2009) The serine protease marapsin is expressed in stratified squamous epithelia and is up-regulated in the hyperproliferative epidermis of psoriasis and regenerating wounds. J Biol Chem. 284(1): 218-28.
  • Size / Price
    Catalog: HG12116-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"