After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Pancreasin/Marapsin/PRSS27 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human PRSS27 cDNA Clone Product Information
NCBI RefSeq:NM_031948.3
RefSeq ORF Size:873bp
cDNA Description:Full length Clone DNA of Homo sapiens protease, serine 27 with N terminal Flag tag.
Gene Synonym:MPN, CAPH2, PRSS27
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

The name "Pancreasin" because it is transcribed strongly in the pancreas. This secreted, tryptic serine protease, also known as Marapsin or PRSS27 (Protease, serine, 27), which is a member of the peptidase S1 family. Pancreasin is inhibited by benzamidine and leupeptin but resists several classic inhibitors of trypsin. Marapsin was constitutively expressed in nonkeratinizing stratified squamous epithelia of human esophagus, tonsil, cervix, larynx, and cornea. In fact, marapsin was the second most strongly up-regulated protease in psoriatic lesions, where expression was localized to the upper region of the hyperplastic epidermis. Similarly, in the hyperproliferative epithelium of regenerating murine skin wounds, marapsin localized to the suprabasal layers, where keratinocytes undergo squamous differentiation. Marapsin's restricted expression, localization, and cytokine-inducible expression suggest a role in the terminal differentiation of keratinocytes in hyperproliferating squamous epithelia.

References
  • Bhagwandin VJ, et al. (2003) Structure and activity of human pancreasin, a novel tryptic serine peptidase expressed primarily by the pancreas. J Biol Chem. 278(5): 3363-71.
  • Li W, et al. (2009) The serine protease marapsin is expressed in stratified squamous epithelia and is up-regulated in the hyperproliferative epidermis of psoriasis and regenerating wounds. J Biol Chem. 284(1): 218-28.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"