Quick Order

Human Trypsin 2/PRSS2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human PRSS2 cDNA Clone Product Information
NCBI RefSeq:NM_002770.2
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of Homo sapiens protease, serine, 2 (trypsin 2) with N terminal His tag.
Gene Synonym:TRY2, TRY8, TRYP2, MGC111183, MGC120174, PRSS2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Mouse Trypsin-2, also known as Trypsin II, Anionic trypsinogen, Serine protease 2, PRSS2 and TRY2, is a secreted protein which belongs to the trypsin serine protease family including Trypsin, PRSS1, PRSS2 and PRSS3. It consists of a signal peptide (residues 1-15), a pro region (residues 16-23), and a proteolytically active mature chain (residues 24-247). PRSS2 contains one peptidase S1 domain. It is secreted into the duodenum, hydrolysing peptides into their smaller building blocks, which is necessary for the uptake of protein in the food. It is secreted by the pancreas in the form of inactive zymogen, trypsinogen and cleaved to its active form in the small intestine when the pancreas is stimulated by cholecystokinin through the common activation mechanism.

References
  • Rawlings, N.D. et al.,1994, Meth. Enzymol. 244: 19–61.
  • Noone, P.G. et al., 2001, Gastroenterology. 121 (6): 1310-9.
  • Leiros, H.K. et al., 2004, Protein Sci. 13 (4): 1056–70.
  • Rónai,Z. et al., 2009, Biochem J. 418 (1):155-61.
  • Size / Price
    Catalog: HG10813-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"