PRRG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13479-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRRG4 Reagents
CRO Services
Product recommended

All PRRG4 Reagents
PRRG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Human proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRRG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
PRGP4 cDNA ORF Clone, Human;TMG4 cDNA ORF Clone, Human
PRRG4 Background Information
Full Name
proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)

PRRG4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PRRG4 cDNA ORF Clone in Cloning Vector, Rat RG80882-U
PRRG4 cDNA ORF Clone, Rat, untagged RG80882-UT
PRRG4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80882-ACG
PRRG4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80882-ACGLN
PRRG4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80882-ACR
PRRG4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80882-CF
PRRG4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80882-NF
PRRG4 cDNA ORF Clone, Rat, C-His tag RG80882-CH
PRRG4 cDNA ORF Clone, Rat, N-His tag RG80882-NH
PRRG4 cDNA ORF Clone, Rat, C-HA tag RG80882-CY
PRRG4 cDNA ORF Clone, Rat, N-HA tag RG80882-NY
PRRG4 cDNA ORF Clone, Rat, C-Myc tag RG80882-CM
PRRG4 cDNA ORF Clone, Rat, N-Myc tag RG80882-NM
PRRG4 qPCR Primer Pairs, Rat RP300846

PRRG4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRRG4 cDNA ORF Clone in Cloning Vector, Human HG13479-G
PRRG4 cDNA ORF Clone, Human, untagged HG13479-UT
PRRG4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13479-ACG
PRRG4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13479-ACGLN
PRRG4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13479-ACR
PRRG4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13479-CF
PRRG4 cDNA ORF Clone, Human, C-His tag HG13479-CH
PRRG4 cDNA ORF Clone, Human, N-His tag HG13479-NH
PRRG4 cDNA ORF Clone, Human, C-HA tag HG13479-CY
PRRG4 cDNA ORF Clone, Human, N-HA tag HG13479-NY
PRRG4 cDNA ORF Clone, Human, C-Myc tag HG13479-CM
PRRG4 cDNA ORF Clone, Human, N-Myc tag HG13479-NM
PRRG4 qPCR Primer Pairs, Human HP102179
info info
添加购物车成功! 添加购物车失败!