PRPF4B cDNA ORF Clone, Human, N-Myc tag

Cat: HG10835-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRPF4B Reagents
CRO Services
Product recommended

All PRPF4B Reagents
PRPF4B cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3024 bp
Description
Full length Clone DNA of Human PRP4 pre-mRNA processing factor 4 homolog B (yeast) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRPF4B cDNA ORF Clone, Human, N-Myc tag Alternative Names
dJ1013A10.1 cDNA ORF Clone, Human;PR4H cDNA ORF Clone, Human;PRP4 cDNA ORF Clone, Human;PRP4H cDNA ORF Clone, Human;PRP4K cDNA ORF Clone, Human
PRPF4B Background Information
Full Name
pre-mRNA processing factor 4B

PRPF4B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRPF4B cDNA ORF Clone in Cloning Vector, Mouse MG50881-G
PRPF4B cDNA ORF Clone, Mouse, untagged MG50881-UT
PRPF4B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50881-ACG
PRPF4B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50881-ACGLN
PRPF4B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50881-ANG
PRPF4B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50881-ACR
PRPF4B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50881-ANR
PRPF4B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50881-CF
PRPF4B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50881-NF
PRPF4B cDNA ORF Clone, Mouse, C-His tag MG50881-CH
PRPF4B cDNA ORF Clone, Mouse, N-His tag MG50881-NH
PRPF4B cDNA ORF Clone, Mouse, C-HA tag MG50881-CY
PRPF4B cDNA ORF Clone, Mouse, N-HA tag MG50881-NY
PRPF4B cDNA ORF Clone, Mouse, C-Myc tag MG50881-CM
PRPF4B cDNA ORF Clone, Mouse, N-Myc tag MG50881-NM
PRPF4B qPCR Primer Pairs, Mouse MP200852

PRPF4B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRPF4B cDNA ORF Clone in Cloning Vector, Human HG10835-M
PRPF4B cDNA ORF Clone, Human, untagged HG10835-UT
PRPF4B cDNA ORF Clone, Human, C-GFPSpark® tag HG10835-ACG
PRPF4B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10835-ACGLN
PRPF4B cDNA ORF Clone, Human, N-GFPSpark® tag HG10835-ANG
PRPF4B cDNA ORF Clone, Human, C-OFPSpark® tag HG10835-ACR
PRPF4B cDNA ORF Clone, Human, N-OFPSpark® tag HG10835-ANR
PRPF4B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10835-CF
PRPF4B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10835-NF
PRPF4B cDNA ORF Clone, Human, C-His tag HG10835-CH
PRPF4B cDNA ORF Clone, Human, N-His tag HG10835-NH
PRPF4B cDNA ORF Clone, Human, C-HA tag HG10835-CY
PRPF4B cDNA ORF Clone, Human, N-HA tag HG10835-NY
PRPF4B cDNA ORF Clone, Human, C-Myc tag HG10835-CM
PRPF4B qPCR Primer Pairs, Human HP100734
info info
添加购物车成功! 添加购物车失败!