Quick Order

Human PRPF3 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human PRPF3 cDNA Clone Product Information
NCBI RefSeq:BC000184
RefSeq ORF Size:2097 bp
cDNA Description:Full length Clone DNA of Homo sapiens PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) with N terminal Myc tag.
Gene Synonym:HPRP3, HPRP3P, PRP3, Prp3p, RP18, PRPF3
Species:Human
Vector:pCMV3-N-Myc
Plasmid:pCMV3-Myc-PRPF3
Restriction Site:KpnI + XbaI(6kb+2.10kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PRPF3 qPCR primers for gene expression analysis, HP102952 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Size / Price
Catalog: HG14302-NM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
  • Human bFGF/FGF2 Gene Plasmid Map 5639
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"