Quick Order

Human PROS1/Protein S Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human PROS1 cDNA Clone Product Information
    NCBI RefSeq:BC015801
    RefSeq ORF Size:2031bp
    cDNA Description:Full length Clone DNA of Homo sapiens protein S (alpha) with N terminal Flag tag.
    Gene Synonym:PSA, PROS, PS21, PS22, PS23, PS24, PS25, PROS1
    Species:Human
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PROS1 qPCR primers for gene expression analysis, HP101835 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    PROS1, also known as protein S, is a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. PROS1 has two isoforms: a free, functionally active form and an inactive form complexed with C4b-binding protein. Besides its anticoagulant function, PROS1 also acts as an agonist for the tyrosine kinase receptors Tyro3, Axl, and Mer. The endothelium expresses Tyro3, Axl, and Mer and produces protein S. The interaction of protein S with endothelial cells and particularly its effects on angiogenesis have not yet been analyzed.

    References
  • Beauchamp NJ. et al., 2004, Br J Haematol. 125 (5): 647-54.
  • García de Frutos P. et al., 2007, Thromb Haemost. 98 (3): 543-56.
  • Rezende SM. et al., 2004, Blood. 103 (4): 1192-201.
  • Size / Price
    Catalog: HG12179-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"