Prokineticin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10183-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Prokineticin 1 Reagents
CRO Services

All Prokineticin 1 Reagents
Prokineticin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
318 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human prokineticin 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XhoI (5.4kb + 0.37kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Prokineticin 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Prokineticin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human EG-VEGF / prokineticin-1 Gene Plasmid Map 7151
Prokineticin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
EGVEGF cDNA ORF Clone, Human;PK1 cDNA ORF Clone, Human;PRK1 cDNA ORF Clone, Human
Prokineticin 1 Background Information

EG-VEGF, also known as prokineticin-1, is a member of the AVIT (prokineticin) family. Prokineticins are secreted proteins that can promote angiogenesis and induce strong gastrointestinal smooth muscle contraction. EG-VEGF can be detected in the steroidogenic glands, ovary, testis, adrenal and placenta. EG-VEGF has little or no effect on a variety of other endothelial and non-endothelial cell types. It induces proliferation, migration and fenestration (the formation of membrane discontinuities) in capillary endothelial cells derived from endocrine glands. It directly influences neuroblastoma progression by promoting the proliferation and migration of neuroblastoma cells. EG-VEGF may play a role in placentation. It may also function in normal and pathological testis angiogenesis. It positively regulates PTGS2 expression and prostaglandin synthesis.

Full Name
prokineticin 1
References
  • Masuda Y, et al. (2002) Isolation and identification of EG-VEGF/prokineticins as cognate ligands for two orphan G-protein-coupled receptors. Biochem. Biophys. Res. Commun. 293 (1): 396-402.
  • Pasquali D. et al. (2006) The endocrine-gland-derived vascular endothelial growth factor (EG-VEGF)/prokineticin 1 and 2 and receptor expression in human prostate: Up-regulation of EG-VEGF/prokineticin 1 with malignancy. Endocrinology. 147 (9): 4245-51.
  • Ngan ES, et al. (2008) Prokineticin-1 (Prok-1) works coordinately with glial cell line-derived neurotrophic factor (GDNF) to mediate proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1783 (3): 467-78.
  • Ngan ES, et al. (2007) Prokineticin-1 modulates proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1773 (4): 536-45.
  • Prokineticin 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Prokineticin 1 cDNA ORF Clone in Cloning Vector, Mouse MG5A1974-U
    Prokineticin 1 cDNA ORF Clone, Mouse, untagged MG5A1974-UT
    Prokineticin 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1974-ACGLN
    Prokineticin 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1974-ACG
    Prokineticin 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1974-ANG
    Prokineticin 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1974-ACR
    Prokineticin 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1974-ANR
    Prokineticin 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1974-CF
    Prokineticin 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1974-NF
    Prokineticin 1 cDNA ORF Clone, Mouse, C-His tag MG5A1974-CH
    Prokineticin 1 cDNA ORF Clone, Mouse, N-His tag MG5A1974-NH
    Prokineticin 1 cDNA ORF Clone, Mouse, C-HA tag MG5A1974-CY
    Prokineticin 1 cDNA ORF Clone, Mouse, N-HA tag MG5A1974-NY
    Prokineticin 1 cDNA ORF Clone, Mouse, C-Myc tag MG5A1974-CM
    Prokineticin 1 cDNA ORF Clone, Mouse, N-Myc tag MG5A1974-NM

    Prokineticin 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Prokineticin 1 cDNA ORF Clone in Cloning Vector, Human HG10183-M
    Prokineticin 1 cDNA ORF Clone, Human, untagged HG10183-UT
    Prokineticin 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10183-ACGLN
    Prokineticin 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10183-ACG
    Prokineticin 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10183-ACR
    Prokineticin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10183-CF
    Prokineticin 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10183-NF
    Prokineticin 1 cDNA ORF Clone, Human, C-His tag HG10183-CH
    Prokineticin 1 cDNA ORF Clone, Human, N-His tag HG10183-NH
    Prokineticin 1 cDNA ORF Clone, Human, C-HA tag HG10183-CY
    Prokineticin 1 cDNA ORF Clone, Human, N-HA tag HG10183-NY
    Prokineticin 1 cDNA ORF Clone, Human, C-Myc tag HG10183-CM
    Prokineticin 1 cDNA ORF Clone, Human, N-Myc tag HG10183-NM
    Prokineticin 1 qPCR Primer Pairs, Human HP100251
    info info
    添加购物车成功! 添加购物车失败!