After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human EG-VEGF / prokineticin-1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human PROK1 cDNA Clone Product Information
NCBI RefSeq:NM_032414.2
RefSeq ORF Size:318bp
cDNA Description:Full length Clone DNA of Homo sapiens prokineticin 1 with N terminal His tag.
Gene Synonym:PROK1, PK1, PRK1, EGVEGF
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

EG-VEGF, also known as prokineticin-1, is a member of the AVIT (prokineticin) family. Prokineticins are secreted proteins that can promote angiogenesis and induce strong gastrointestinal smooth muscle contraction. EG-VEGF can be detected in the steroidogenic glands, ovary, testis, adrenal and placenta. EG-VEGF has little or no effect on a variety of other endothelial and non-endothelial cell types. It induces proliferation, migration and fenestration (the formation of membrane discontinuities) in capillary endothelial cells derived from endocrine glands. It directly influences neuroblastoma progression by promoting the proliferation and migration of neuroblastoma cells. EG-VEGF may play a role in placentation. It may also function in normal and pathological testis angiogenesis. It positively regulates PTGS2 expression and prostaglandin synthesis.

References
  • Masuda Y, et al. (2002) Isolation and identification of EG-VEGF/prokineticins as cognate ligands for two orphan G-protein-coupled receptors. Biochem. Biophys. Res. Commun. 293 (1): 396-402.
  • Pasquali D. et al. (2006) The endocrine-gland-derived vascular endothelial growth factor (EG-VEGF)/prokineticin 1 and 2 and receptor expression in human prostate: Up-regulation of EG-VEGF/prokineticin 1 with malignancy. Endocrinology. 147 (9): 4245-51.
  • Ngan ES, et al. (2008) Prokineticin-1 (Prok-1) works coordinately with glial cell line-derived neurotrophic factor (GDNF) to mediate proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1783 (3): 467-78.
  • Ngan ES, et al. (2007) Prokineticin-1 modulates proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1773 (4): 536-45.
  • Size / Price
    Catalog: HG10183-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"