PRMT8 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11328-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PRMT8 Reagents
CRO Services
Product recommended

All PRMT8 Reagents
PRMT8 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1230 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein arginine methyltransferase 8 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI(6kb+1.23kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PRMT8 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRMT8 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
PRMT8 cDNA ORF Clone, Human, C-Myc tag Alternative Names
HRMT1L3 cDNA ORF Clone, Human;HRMT1L4 cDNA ORF Clone, Human
PRMT8 Background Information
Full Name
protein arginine methyltransferase 8

PRMT8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRMT8 cDNA ORF Clone in Cloning Vector, Mouse MG52335-G
PRMT8 cDNA ORF Clone, Mouse, untagged MG52335-UT
PRMT8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52335-ACGLN
PRMT8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52335-ACG
PRMT8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52335-ANG
PRMT8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52335-ACR
PRMT8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52335-ANR
PRMT8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52335-CF
PRMT8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52335-NF
PRMT8 cDNA ORF Clone, Mouse, C-His tag MG52335-CH
PRMT8 cDNA ORF Clone, Mouse, N-His tag MG52335-NH
PRMT8 cDNA ORF Clone, Mouse, C-HA tag MG52335-CY
PRMT8 cDNA ORF Clone, Mouse, N-HA tag MG52335-NY
PRMT8 cDNA ORF Clone, Mouse, C-Myc tag MG52335-CM
PRMT8 cDNA ORF Clone, Mouse, N-Myc tag MG52335-NM
PRMT8 qPCR Primer Pairs, Mouse MP202208

PRMT8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRMT8 cDNA ORF Clone in Cloning Vector, Human HG11328-M
PRMT8 cDNA ORF Clone, Human, untagged HG11328-UT
PRMT8 cDNA ORF Clone, Human, C-GFPSpark® tag HG11328-ACG
PRMT8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11328-ACGLN
PRMT8 cDNA ORF Clone, Human, C-OFPSpark® tag HG11328-ACR
PRMT8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11328-CF
PRMT8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11328-NF
PRMT8 cDNA ORF Clone, Human, C-His tag HG11328-CH
PRMT8 cDNA ORF Clone, Human, N-His tag HG11328-NH
PRMT8 cDNA ORF Clone, Human, C-HA tag HG11328-CY
PRMT8 cDNA ORF Clone, Human, N-HA tag HG11328-NY
PRMT8 cDNA ORF Clone, Human, N-Myc tag HG11328-NM
PRMT8 qPCR Primer Pairs, Human HP101213
info info
添加购物车成功! 添加购物车失败!