PRMT3 cDNA ORF Clone, Human, C-HA tag

Cat: HG11211-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRMT3 Reagents
CRO Services
Product recommended

All PRMT3 Reagents
PRMT3 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1638 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein arginine methyltransferase 3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+1.64kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PRMT3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRMT3 cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
PRMT3 cDNA ORF Clone, Human, C-HA tag Alternative Names
HRMT1L3 cDNA ORF Clone, Human
PRMT3 Background Information

Protein arginine methyltransferase 3, also known as PRMT3, is one of four type I  protein arginine methyltransferases (PRMT)  that in humans is encoded by the PRMT3 gene. Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. In human cells, the PRMT family consists of eight canonical members. PRMTs have been classified into two groups based on the end product. Certain PRMTs display different subcellular localization in different cell types, implicating cell- and tissue-specific mechanisms for regulating PRMT functions. PRMT3 is unique in that its N-terminus harbours a C2H2 zinc-finger domain that is proposed to confer substrate specificity. In addition, PRMT3 is the only type I  enzyme that is restricted to the cytoplasm. A large proportion of this cystosolic PRMT3 is found associated with ribosomes. It is tethered to the ribosomes through its interaction with rpS2, which is also its substrate.

Full Name
protein arginine methyltransferase 3
References
  • Swiercz, R. et al., 2005, Biochem J. 386 (Pt 1): 85-91.
  • Iwasaki, H., 2008, Biochem Biophys Res Commun  372 (2): 314-9.
  • Lei, NZ. et al., 2009, Nucleic acids Res 37 (3): 832-48.
  • Fan, Q. et al., 2009, Biochem J. 421 (1): 107-18.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • Kölbel, K. J Biol Chem 2009, 284 (13): 8274-82.
  • PRMT3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PRMT3 cDNA ORF Clone in Cloning Vector, Mouse MG5A1495-G
    PRMT3 cDNA ORF Clone, Mouse, untagged MG5A1495-UT
    PRMT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1495-ACGLN
    PRMT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1495-ACG
    PRMT3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1495-ANG
    PRMT3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1495-ACR
    PRMT3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1495-ANR
    PRMT3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1495-CF
    PRMT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1495-NF
    PRMT3 cDNA ORF Clone, Mouse, C-His tag MG5A1495-CH
    PRMT3 cDNA ORF Clone, Mouse, N-His tag MG5A1495-NH
    PRMT3 cDNA ORF Clone, Mouse, C-HA tag MG5A1495-CY
    PRMT3 cDNA ORF Clone, Mouse, N-HA tag MG5A1495-NY
    PRMT3 cDNA ORF Clone, Mouse, C-Myc tag MG5A1495-CM
    PRMT3 cDNA ORF Clone, Mouse, N-Myc tag MG5A1495-NM

    PRMT3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PRMT3 cDNA ORF Clone in Cloning Vector, Human HG11211-M
    PRMT3 cDNA ORF Clone, Human, untagged HG11211-UT
    PRMT3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11211-ACG
    PRMT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11211-ACGLN
    PRMT3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11211-ANG
    PRMT3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11211-ACR
    PRMT3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11211-ANR
    PRMT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11211-CF
    PRMT3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11211-NF
    PRMT3 cDNA ORF Clone, Human, C-His tag HG11211-CH
    PRMT3 cDNA ORF Clone, Human, N-His tag HG11211-NH
    PRMT3 cDNA ORF Clone, Human, N-HA tag HG11211-NY
    PRMT3 cDNA ORF Clone, Human, C-Myc tag HG11211-CM
    PRMT3 cDNA ORF Clone, Human, N-Myc tag HG11211-NM
    PRMT3 qPCR Primer Pairs, Human HP101115
    info info
    添加购物车成功! 添加购物车失败!