Quick Order

Text Size:AAA

Human PRMT3 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human PRMT3 cDNA Clone Product Information
NCBI RefSeq:NM_005788.3
RefSeq ORF Size:1596bp
cDNA Description:Full length Clone DNA of Homo sapiens protein arginine methyltransferase 3 with C terminal HA tag.
Gene Synonym:HRMT1L3, PRMT3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Protein arginine methyltransferase 3, also known as PRMT3, is one of four type I  protein arginine methyltransferases (PRMT)  that in humans is encoded by the PRMT3 gene. Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. In human cells, the PRMT family consists of eight canonical members. PRMTs have been classified into two groups based on the end product. Certain PRMTs display different subcellular localization in different cell types, implicating cell- and tissue-specific mechanisms for regulating PRMT functions. PRMT3 is unique in that its N-terminus harbours a C2H2 zinc-finger domain that is proposed to confer substrate specificity. In addition, PRMT3 is the only type I  enzyme that is restricted to the cytoplasm. A large proportion of this cystosolic PRMT3 is found associated with ribosomes. It is tethered to the ribosomes through its interaction with rpS2, which is also its substrate.

References
  • Swiercz, R. et al., 2005, Biochem J. 386 (Pt 1): 85-91.
  • Iwasaki, H., 2008, Biochem Biophys Res Commun  372 (2): 314-9.
  • Lei, NZ. et al., 2009, Nucleic acids Res 37 (3): 832-48.
  • Fan, Q. et al., 2009, Biochem J. 421 (1): 107-18.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • Kölbel, K. J Biol Chem 2009, 284 (13): 8274-82.
  • Size / Price
    Catalog: HG11211-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"