PRMT1 cDNA ORF Clone, Human, C-HA tag

Cat: HG11210-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRMT1 Reagents
CRO Services
Product recommended

All PRMT1 Reagents
PRMT1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1116 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein arginine methyltransferase 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI (6kb + 1.16kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PRMT1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRMT1 cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
Human PRMT1/HRMT1L2 Gene Expression validated Image 16757
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-HA Tag monoclonal antibody (100028-MM10) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
PRMT1 cDNA ORF Clone, Human, C-HA tag Alternative Names
ANM1 cDNA ORF Clone, Human;HCP1 cDNA ORF Clone, Human;HRMT1L2 cDNA ORF Clone, Human;IR1B4 cDNA ORF Clone, Human
PRMT1 Background Information
Full Name
protein arginine methyltransferase 1

PRMT1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PRMT1 cDNA ORF Clone in Cloning Vector, Canine DG70178-U
PRMT1 cDNA ORF Clone, Canine, untagged DG70178-UT
PRMT1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70178-ACGLN
PRMT1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70178-ACG
PRMT1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70178-ANG
PRMT1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70178-ACR
PRMT1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70178-ANR
PRMT1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70178-CF
PRMT1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70178-NF
PRMT1 cDNA ORF Clone, Canine, C-His tag DG70178-CH
PRMT1 cDNA ORF Clone, Canine, N-His tag DG70178-NH
PRMT1 cDNA ORF Clone, Canine, C-HA tag DG70178-CY
PRMT1 cDNA ORF Clone, Canine, N-HA tag DG70178-NY
PRMT1 cDNA ORF Clone, Canine, C-Myc tag DG70178-CM
PRMT1 cDNA ORF Clone, Canine, N-Myc tag DG70178-NM

PRMT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRMT1 cDNA ORF Clone in Cloning Vector, Mouse MG53838-U
PRMT1 cDNA ORF Clone, Mouse, untagged MG53838-UT
PRMT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53838-ACG
PRMT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53838-ACGLN
PRMT1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53838-ANG
PRMT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53838-ACR
PRMT1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53838-ANR
PRMT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53838-CF
PRMT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53838-NF
PRMT1 cDNA ORF Clone, Mouse, C-His tag MG53838-CH
PRMT1 cDNA ORF Clone, Mouse, N-His tag MG53838-NH
PRMT1 cDNA ORF Clone, Mouse, C-HA tag MG53838-CY
PRMT1 cDNA ORF Clone, Mouse, N-HA tag MG53838-NY
PRMT1 cDNA ORF Clone, Mouse, C-Myc tag MG53838-CM
PRMT1 cDNA ORF Clone, Mouse, N-Myc tag MG53838-NM

PRMT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRMT1 cDNA ORF Clone in Cloning Vector, Human HG11210-M
PRMT1 cDNA ORF Clone, Human, untagged HG11210-UT
PRMT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11210-ACGLN
PRMT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11210-ACG
PRMT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11210-ANG
PRMT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11210-ACR
PRMT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11210-ANR
PRMT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11210-CF
PRMT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11210-NF
PRMT1 cDNA ORF Clone, Human, C-His tag HG11210-CH
PRMT1 cDNA ORF Clone, Human, N-His tag HG11210-NH
PRMT1 cDNA ORF Clone, Human, N-HA tag HG11210-NY
PRMT1 cDNA ORF Clone, Human, C-Myc tag HG11210-CM
PRMT1 cDNA ORF Clone, Human, N-Myc tag HG11210-NM
PRMT1 qPCR Primer Pairs, Human HP101114
info info
添加购物车成功! 添加购物车失败!