PRKG2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11365-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRKG2 Reagents
CRO Services
Product recommended

All PRKG2 Reagents
PRKG2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2289 bp
Description
Full length Clone DNA of Human protein kinase, cGMP-dependent, type I I with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRKG2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
cGK2 cDNA ORF Clone, Human;cGKII cDNA ORF Clone, Human;PRKGR2 cDNA ORF Clone, Human
PRKG2 Background Information
Full Name
protein kinase, cGMP-dependent, type II

PRKG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRKG2 cDNA ORF Clone in Cloning Vector, Mouse MG52705-G
PRKG2 cDNA ORF Clone, Mouse, untagged MG52705-UT
PRKG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52705-ACG
PRKG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52705-ACGLN
PRKG2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52705-ANG
PRKG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52705-ACR
PRKG2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52705-ANR
PRKG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52705-CF
PRKG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52705-NF
PRKG2 cDNA ORF Clone, Mouse, C-His tag MG52705-CH
PRKG2 cDNA ORF Clone, Mouse, N-His tag MG52705-NH
PRKG2 cDNA ORF Clone, Mouse, C-HA tag MG52705-CY
PRKG2 cDNA ORF Clone, Mouse, N-HA tag MG52705-NY
PRKG2 cDNA ORF Clone, Mouse, C-Myc tag MG52705-CM
PRKG2 cDNA ORF Clone, Mouse, N-Myc tag MG52705-NM
PRKG2 qPCR Primer Pairs, Mouse MP202576

PRKG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRKG2 cDNA ORF Clone in Cloning Vector, Human HG11365-M
PRKG2 cDNA ORF Clone, Human, untagged HG11365-UT
PRKG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11365-ACGLN
PRKG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11365-ACG
PRKG2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11365-ANG
PRKG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11365-ACR
PRKG2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11365-ANR
PRKG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11365-CF
PRKG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11365-NF
PRKG2 cDNA ORF Clone, Human, C-His tag HG11365-CH
PRKG2 cDNA ORF Clone, Human, N-His tag HG11365-NH
PRKG2 cDNA ORF Clone, Human, C-HA tag HG11365-CY
PRKG2 cDNA ORF Clone, Human, N-HA tag HG11365-NY
PRKG2 cDNA ORF Clone, Human, N-Myc tag HG11365-NM
PRKG2 qPCR Primer Pairs, Human HP101247
info info
添加购物车成功! 添加购物车失败!