Protein Kinase D2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11671-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Protein Kinase D2 Reagents
CRO Services
Product recommended

All Protein Kinase D2 Reagents
Protein Kinase D2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2676 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1389C/T, not causing the amino acid variation.
Description
Full length Clone DNA of Human protein kinase D2PRKD2 protein kinase D2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI+XbaI(6kb+2.68kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Protein Kinase D2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Protein Kinase D2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human PRKD2 Gene Expression validated Image 14381
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Protein Kinase D2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HSPC187 cDNA ORF Clone, Human;nPKC-D2 cDNA ORF Clone, Human;PKD2 cDNA ORF Clone, Human
Protein Kinase D2 Background Information

Serine/threonine-protein kinase D2, also known as PRKD2 and PKD2, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD2 / PKD2 is widely expressed. It contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. PRKD2 / PKD2 is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains bind DAG, mediating translocation to membranes. Autophosphorylation of Ser-710 and phosphorylation of Ser-706 by PKC relieves auto-inhibition by the PH domain. PRKD2 / PKD2 converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. Involved in resistance to oxidative stress.

Full Name
protein kinase D2
References
  • Zhang QH, et al., 2000, Genome Res 10 (10): 1546-60.
  • Di Bernardo MC, et al.,2008, Nature genetics. 40 (10) :1204-10.
  • Zhang L, et al., 2009, American journal of nephrology. 30 (6) :505-13.
  • info info
    添加购物车成功! 添加购物车失败!